Mutagenetix > Incidental Mutations

Incidental Mutation 'R1549:Eef2'

169791

Institutional Source

Beutler Lab

Gene Symbol

Eef2

Ensembl Gene

ENSMUSG00000034994

Gene Name

eukaryotic translation elongation factor 2

Synonyms

Ef-2

MMRRC Submission

039588-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.965) question?

Stock #

R1549 (G1)

Quality Score

139

Status

Not validated

Chromosome

Chromosomal Location

81176631-81182498 bp(+) (GRCm38)

Type of Mutation

frame shift

DNA Base Change (assembly)

CCC to CCCC at 81178768 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000046101 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047665] [ENSMUST00000047864] [ENSMUST00000056086] [ENSMUST00000178422] [ENSMUST00000218157] [ENSMUST00000219133]

Predicted Effect

probably benign
Transcript: ENSMUST00000047665

SMART Domains

Protein: ENSMUSP00000035962
Gene: ENSMUSG00000034974

Domain	Start	End	E-Value	Type
S_TKc	13	275	1.93e-98	SMART
low complexity region	288	299	N/A	INTRINSIC
low complexity region	331	347	N/A	INTRINSIC
low complexity region	349	411	N/A	INTRINSIC
coiled coil region	419	444	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000047864

SMART Domains

Protein: ENSMUSP00000046101
Gene: ENSMUSG00000034994

Domain	Start	End	E-Value	Type
Pfam:GTP_EFTU	17	360	2e-65	PFAM
Pfam:MMR_HSR1	21	159	6.3e-6	PFAM
Pfam:GTP_EFTU_D2	409	486	2.3e-14	PFAM
Pfam:EFG_II	501	568	1.9e-14	PFAM
EFG_IV	621	737	5.56e-27	SMART
EFG_C	739	828	4.06e-20	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000056086

SMART Domains

Protein: ENSMUSP00000049685
Gene: ENSMUSG00000053603

Domain	Start	End	E-Value	Type
low complexity region	2	14	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000082507

Predicted Effect

probably benign
Transcript: ENSMUST00000178422

SMART Domains

Protein: ENSMUSP00000137333
Gene: ENSMUSG00000034974

Domain	Start	End	E-Value	Type
S_TKc	13	275	1.93e-98	SMART
low complexity region	288	299	N/A	INTRINSIC
low complexity region	331	347	N/A	INTRINSIC
low complexity region	349	411	N/A	INTRINSIC
coiled coil region	419	444	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000217936

Predicted Effect

probably benign
Transcript: ENSMUST00000218157

Predicted Effect

probably benign
Transcript: ENSMUST00000219133

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219329

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219497

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219943

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220076

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.8%
20x: 90.8%

Validation Efficiency

97% (58/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the GTP-binding translation elongation factor family. This protein is an essential factor for protein synthesis. It promotes the GTP-dependent translocation of the nascent protein chain from the A-site to the P-site of the ribosome. This protein is completely inactivated by EF-2 kinase phosporylation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a mutation removing the diphthamide modification display partial neonatal lethality, fetal growth retardation and abnormal cell physiology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700006A11Rik	A	T	3: 124,416,792	I157K	probably benign	Het
Ank3	A	T	10: 70,001,982	N727Y	probably benign	Het
Atg16l1	A	G	1: 87,774,188	T251A	probably benign	Het
Bcl11b	T	A	12: 107,917,163	I226F	probably damaging	Het
Birc6	A	G	17: 74,662,742	H4260R	probably damaging	Het
Camta1	A	G	4: 151,586,463	I85T	probably damaging	Het
Cblb	A	G	16: 52,033,010		probably benign	Het
Ccnd1	T	G	7: 144,937,336	I178L	probably benign	Het
Clcn4	A	G	7: 7,291,682	V329A	probably damaging	Het
Col17a1	C	T	19: 47,648,910		probably benign	Het
Col7a1	A	G	9: 108,955,966	T254A	unknown	Het
Ctif	C	A	18: 75,565,025	R188L	probably damaging	Het
Cyp2c69	A	T	19: 39,842,986	L461Q	probably benign	Het
Ddc	A	G	11: 11,846,656		probably null	Het
Dpp10	T	A	1: 123,341,380		probably null	Het
Eif2b4	T	C	5: 31,192,921	E19G	possibly damaging	Het
Fmnl2	A	G	2: 53,105,537	E424G	probably damaging	Het
Galnt14	A	G	17: 73,525,313	L269P	possibly damaging	Het
Gm14409	T	C	2: 177,265,585	E40G	probably damaging	Het
Gm2381	T	A	7: 42,822,401	H18L	probably benign	Het
Gpbp1	G	T	13: 111,436,579	D326E	probably benign	Het
Gpr162	C	T	6: 124,860,088	R331H	probably damaging	Het
Iigp1	G	A	18: 60,389,876	G22D	probably benign	Het
Kcns3	T	C	12: 11,092,083	H205R	probably damaging	Het
Klk1b26	C	T	7: 44,016,402		probably benign	Het
Lime1	A	G	2: 181,383,376	Y242C	probably benign	Het
Manba	A	G	3: 135,544,806	D398G	probably damaging	Het
Mapk3	A	T	7: 126,763,512	K219*	probably null	Het
Mdfic	G	T	6: 15,799,845	G324C	probably damaging	Het
Mdga1	G	A	17: 29,837,998	H837Y	probably damaging	Het
Nck1	T	A	9: 100,497,872	M109L	probably benign	Het
Olfr1369-ps1	T	C	13: 21,116,118	V142A	probably benign	Het
Olfr412	A	G	11: 74,365,250	I194V	probably benign	Het
Pabpc1l	G	T	2: 164,037,171	V313F	possibly damaging	Het
Phf3	C	T	1: 30,804,842	V1679I	probably benign	Het
Pou4f1	T	C	14: 104,467,640	I32V	probably benign	Het
Pspc1	T	G	14: 56,748,941	H351P	probably damaging	Het
Ptk7	T	C	17: 46,572,652	E829G	probably damaging	Het
Rab23	A	G	1: 33,738,297	Y164C	possibly damaging	Het
Slc36a3	A	G	11: 55,142,770	W141R	probably damaging	Het
Slc7a14	T	C	3: 31,224,118	E446G	possibly damaging	Het
Stim2	G	A	5: 54,105,325	R303Q	probably damaging	Het
Tbcd	A	G	11: 121,560,753	I550V	probably benign	Het
Tmed3	A	C	9: 89,699,945	L155R	probably damaging	Het
Trav16d-dv11	A	G	14: 53,047,342		probably benign	Het
Ubap2	C	T	4: 41,199,872	A752T	probably benign	Het
Usp16	G	T	16: 87,464,834	V113F	probably damaging	Het
Vmn2r12	T	G	5: 109,092,830	Y139S	probably benign	Het
Vmn2r5	G	T	3: 64,504,000	D382E	probably damaging	Het
Zfp217	A	C	2: 170,114,470	N869K	probably benign	Het
Zswim2	G	T	2: 83,923,748	D189E	probably benign	Het

Other mutations in Eef2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01303:Eef2	APN	10	81181943	missense	possibly damaging	0.93
IGL01303:Eef2	APN	10	81181982	splice site	probably null
IGL01376:Eef2	APN	10	81178049	unclassified	probably benign
IGL01876:Eef2	APN	10	81180270	missense	probably benign
IGL02000:Eef2	APN	10	81180011	missense	probably benign	0.13
IGL02514:Eef2	APN	10	81179593	missense	probably benign	0.11
IGL03087:Eef2	APN	10	81181247	missense	probably benign	0.12
IGL03389:Eef2	APN	10	81179706	missense	probably benign	0.40
fig	UTSW	10	81180292	missense	possibly damaging	0.50
R0052:Eef2	UTSW	10	81178768	frame shift	probably null
R0178:Eef2	UTSW	10	81180292	missense	possibly damaging	0.50
R0445:Eef2	UTSW	10	81178770	frame shift	probably null
R0497:Eef2	UTSW	10	81181586	missense	probably benign	0.00
R0539:Eef2	UTSW	10	81178768	frame shift	probably null
R0745:Eef2	UTSW	10	81181996	missense	probably benign	0.00
R0811:Eef2	UTSW	10	81178769	frame shift	probably null
R0812:Eef2	UTSW	10	81178769	frame shift	probably null
R0832:Eef2	UTSW	10	81178769	frame shift	probably null
R1136:Eef2	UTSW	10	81178769	frame shift	probably null
R1298:Eef2	UTSW	10	81178768	frame shift	probably null
R1550:Eef2	UTSW	10	81180847	missense	probably benign	0.04
R2869:Eef2	UTSW	10	81178767	frame shift	probably null
R2870:Eef2	UTSW	10	81178767	frame shift	probably null
R2871:Eef2	UTSW	10	81178767	frame shift	probably null
R2872:Eef2	UTSW	10	81178767	frame shift	probably null
R3408:Eef2	UTSW	10	81178767	frame shift	probably null
R3414:Eef2	UTSW	10	81177858	missense	probably damaging	0.98
R4291:Eef2	UTSW	10	81179580	missense	probably benign	0.00
R4357:Eef2	UTSW	10	81178767	frame shift	probably null
R4433:Eef2	UTSW	10	81178768	frame shift	probably null
R4577:Eef2	UTSW	10	81178767	frame shift	probably null
R5154:Eef2	UTSW	10	81178767	frame shift	probably null
R5609:Eef2	UTSW	10	81178769	frame shift	probably null
R6545:Eef2	UTSW	10	81181114	missense	probably damaging	1.00
R6649:Eef2	UTSW	10	81178768	frame shift	probably null
R6650:Eef2	UTSW	10	81178768	frame shift	probably null
R7326:Eef2	UTSW	10	81181282	missense	probably benign	0.26
R7472:Eef2	UTSW	10	81179550	missense	probably benign	0.01
R7579:Eef2	UTSW	10	81178768	frame shift	probably null
R8013:Eef2	UTSW	10	81178196	missense	probably damaging	1.00
R8143:Eef2	UTSW	10	81181348	missense	probably damaging	1.00
Z1088:Eef2	UTSW	10	81181889	missense	probably damaging	1.00
Z1176:Eef2	UTSW	10	81181158	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- TGTATGTGCCAGTCCCCATGTCAG -3'
(R):5'- TCATGGTGGGTCAGAGATTCCCAG -3'

Sequencing Primer
(F):5'- TGGTACACTGGACACACTTG -3'
(R):5'- TCAGAGATTCCCAGGGAGC -3'

Posted On

2014-04-13