Mutagenetix > Incidental Mutations

Incidental Mutation 'R1549:Mdga1'

169805

Institutional Source

Beutler Lab

Gene Symbol

Mdga1

Ensembl Gene

ENSMUSG00000043557

Gene Name

MAM domain containing glycosylphosphatidylinositol anchor 1

Synonyms

MMRRC Submission

039588-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.293) question?

Stock #

R1549 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

29827956-29970087 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 29837998 bp

Zygosity

Heterozygous

Amino Acid Change

Histidine to Tyrosine at position 837 (H837Y)

Ref Sequence

ENSEMBL: ENSMUSP00000073246 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000073556] [ENSMUST00000167190] [ENSMUST00000168044] [ENSMUST00000171691]

Predicted Effect

probably damaging
Transcript: ENSMUST00000073556
AA Change: H837Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000073246
Gene: ENSMUSG00000043557
AA Change: H837Y

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
IGc2	51	115	1.62e-12	SMART
IG	142	236	3.2e-2	SMART
IGc2	253	315	6.25e-14	SMART
IGc2	348	422	3.54e-4	SMART
IGc2	454	521	6.55e-8	SMART
IGc2	551	623	9.49e-5	SMART
FN3	642	731	2.05e0	SMART
MAM	741	911	1.02e-52	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000165528

Predicted Effect

probably benign
Transcript: ENSMUST00000167190

SMART Domains

Protein: ENSMUSP00000130395
Gene: ENSMUSG00000043557

Domain	Start	End	E-Value	Type
low complexity region	236	246	N/A	INTRINSIC
low complexity region	251	265	N/A	INTRINSIC
IGc2	325	389	1.62e-12	SMART
IG	416	510	3.2e-2	SMART
IGc2	527	589	6.25e-14	SMART
IGc2	622	696	3.54e-4	SMART
IGc2	728	795	6.55e-8	SMART
IGc2	825	897	9.49e-5	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000168044
AA Change: H138Y

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000126571
Gene: ENSMUSG00000043557
AA Change: H138Y

Domain	Start	End	E-Value	Type
Pfam:MAM	47	186	3.1e-41	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000170786

Predicted Effect

possibly damaging
Transcript: ENSMUST00000171691
AA Change: H845Y

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000126529
Gene: ENSMUSG00000043557
AA Change: H845Y

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
IGc2	51	115	1.62e-12	SMART
IG	142	236	3.2e-2	SMART
IGc2	253	315	6.25e-14	SMART
IGc2	348	422	3.54e-4	SMART
IGc2	454	521	6.55e-8	SMART
IGc2	551	623	9.49e-5	SMART
FN3	642	731	2.05e0	SMART
MAM	749	919	3.61e-53	SMART

Meta Mutation Damage Score

0.4910

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.8%
20x: 90.8%

Validation Efficiency

97% (58/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycosylphosphatidylinositol (GPI)-anchored cell surface glycoprotein that is expressed predominantly in the developing nervous system. In addition to possessing several cell adhesion molecule-like domains, the mature protein has six Ig-like domains, a single fibronectin type III domain, a MAM domain and a C-terminal GPI-anchoring site. Studies in other mammals suggest this protein plays a role in cell adhesion, migration, and axon guidance and, in the developing brain, neuronal migration. In humans, this gene is associated with bipolar disorder and schizophrenia. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal neuronal migration during corticogenesis that is resolved by P7 [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700006A11Rik	A	T	3: 124,416,792	I157K	probably benign	Het
Ank3	A	T	10: 70,001,982	N727Y	probably benign	Het
Atg16l1	A	G	1: 87,774,188	T251A	probably benign	Het
Bcl11b	T	A	12: 107,917,163	I226F	probably damaging	Het
Birc6	A	G	17: 74,662,742	H4260R	probably damaging	Het
Camta1	A	G	4: 151,586,463	I85T	probably damaging	Het
Cblb	A	G	16: 52,033,010		probably benign	Het
Ccnd1	T	G	7: 144,937,336	I178L	probably benign	Het
Clcn4	A	G	7: 7,291,682	V329A	probably damaging	Het
Col17a1	C	T	19: 47,648,910		probably benign	Het
Col7a1	A	G	9: 108,955,966	T254A	unknown	Het
Ctif	C	A	18: 75,565,025	R188L	probably damaging	Het
Cyp2c69	A	T	19: 39,842,986	L461Q	probably benign	Het
Ddc	A	G	11: 11,846,656		probably null	Het
Dpp10	T	A	1: 123,341,380		probably null	Het
Eef2	CCC	CCCC	10: 81,178,768		probably null	Het
Eif2b4	T	C	5: 31,192,921	E19G	possibly damaging	Het
Fmnl2	A	G	2: 53,105,537	E424G	probably damaging	Het
Galnt14	A	G	17: 73,525,313	L269P	possibly damaging	Het
Gm14409	T	C	2: 177,265,585	E40G	probably damaging	Het
Gm2381	T	A	7: 42,822,401	H18L	probably benign	Het
Gpbp1	G	T	13: 111,436,579	D326E	probably benign	Het
Gpr162	C	T	6: 124,860,088	R331H	probably damaging	Het
Iigp1	G	A	18: 60,389,876	G22D	probably benign	Het
Kcns3	T	C	12: 11,092,083	H205R	probably damaging	Het
Klk1b26	C	T	7: 44,016,402		probably benign	Het
Lime1	A	G	2: 181,383,376	Y242C	probably benign	Het
Manba	A	G	3: 135,544,806	D398G	probably damaging	Het
Mapk3	A	T	7: 126,763,512	K219*	probably null	Het
Mdfic	G	T	6: 15,799,845	G324C	probably damaging	Het
Nck1	T	A	9: 100,497,872	M109L	probably benign	Het
Olfr1369-ps1	T	C	13: 21,116,118	V142A	probably benign	Het
Olfr412	A	G	11: 74,365,250	I194V	probably benign	Het
Pabpc1l	G	T	2: 164,037,171	V313F	possibly damaging	Het
Phf3	C	T	1: 30,804,842	V1679I	probably benign	Het
Pou4f1	T	C	14: 104,467,640	I32V	probably benign	Het
Pspc1	T	G	14: 56,748,941	H351P	probably damaging	Het
Ptk7	T	C	17: 46,572,652	E829G	probably damaging	Het
Rab23	A	G	1: 33,738,297	Y164C	possibly damaging	Het
Slc36a3	A	G	11: 55,142,770	W141R	probably damaging	Het
Slc7a14	T	C	3: 31,224,118	E446G	possibly damaging	Het
Stim2	G	A	5: 54,105,325	R303Q	probably damaging	Het
Tbcd	A	G	11: 121,560,753	I550V	probably benign	Het
Tmed3	A	C	9: 89,699,945	L155R	probably damaging	Het
Trav16d-dv11	A	G	14: 53,047,342		probably benign	Het
Ubap2	C	T	4: 41,199,872	A752T	probably benign	Het
Usp16	G	T	16: 87,464,834	V113F	probably damaging	Het
Vmn2r12	T	G	5: 109,092,830	Y139S	probably benign	Het
Vmn2r5	G	T	3: 64,504,000	D382E	probably damaging	Het
Zfp217	A	C	2: 170,114,470	N869K	probably benign	Het
Zswim2	G	T	2: 83,923,748	D189E	probably benign	Het

Other mutations in Mdga1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01576:Mdga1	APN	17	29843127	missense	possibly damaging	0.50
IGL01637:Mdga1	APN	17	29839871	missense	probably damaging	1.00
IGL02130:Mdga1	APN	17	29857669	missense	possibly damaging	0.96
IGL02596:Mdga1	APN	17	29832405	splice site	probably benign
IGL03258:Mdga1	APN	17	29839913	missense	probably damaging	1.00
R0184:Mdga1	UTSW	17	29852442	missense	probably damaging	1.00
R0366:Mdga1	UTSW	17	29857708	missense	possibly damaging	0.85
R1017:Mdga1	UTSW	17	29850548	missense	probably damaging	0.98
R1520:Mdga1	UTSW	17	29846519	missense	probably benign	0.12
R1545:Mdga1	UTSW	17	29842902	missense	probably damaging	1.00
R1671:Mdga1	UTSW	17	29850629	missense	probably damaging	1.00
R1875:Mdga1	UTSW	17	29852607	missense	probably damaging	1.00
R1893:Mdga1	UTSW	17	29849226	missense	probably damaging	1.00
R1958:Mdga1	UTSW	17	29840888	missense	probably damaging	1.00
R1983:Mdga1	UTSW	17	29850605	missense	probably damaging	1.00
R2014:Mdga1	UTSW	17	29849313	missense	probably damaging	1.00
R2894:Mdga1	UTSW	17	29852504	missense	probably damaging	1.00
R2964:Mdga1	UTSW	17	29852468	missense	probably damaging	1.00
R3813:Mdga1	UTSW	17	29838479	missense	probably damaging	1.00
R3938:Mdga1	UTSW	17	29857622	missense	probably damaging	1.00
R3982:Mdga1	UTSW	17	29931264	missense	unknown
R4063:Mdga1	UTSW	17	29838031	missense	probably damaging	1.00
R4157:Mdga1	UTSW	17	29833343	missense	probably benign	0.32
R4183:Mdga1	UTSW	17	29969990	missense	unknown
R4392:Mdga1	UTSW	17	29850656	missense	probably damaging	1.00
R4393:Mdga1	UTSW	17	29850517	missense	probably damaging	1.00
R4396:Mdga1	UTSW	17	29850517	missense	probably damaging	1.00
R4806:Mdga1	UTSW	17	29842154	missense	probably benign	0.20
R4829:Mdga1	UTSW	17	29846369	missense	possibly damaging	0.91
R4923:Mdga1	UTSW	17	29838078	missense	probably damaging	0.99
R4932:Mdga1	UTSW	17	29857606	missense	probably damaging	1.00
R5015:Mdga1	UTSW	17	29839873	missense	possibly damaging	0.71
R5076:Mdga1	UTSW	17	29850554	missense	possibly damaging	0.93
R5141:Mdga1	UTSW	17	29852493	missense	probably benign	0.43
R5180:Mdga1	UTSW	17	29857736	splice site	probably benign
R5590:Mdga1	UTSW	17	29839867	missense	probably damaging	1.00
R5747:Mdga1	UTSW	17	29850551	missense	probably benign	0.11
R5748:Mdga1	UTSW	17	29850551	missense	probably benign	0.11
R6207:Mdga1	UTSW	17	29838517	missense	probably damaging	1.00
R6826:Mdga1	UTSW	17	29970026	missense	unknown
R6831:Mdga1	UTSW	17	29887516	nonsense	probably null
R7114:Mdga1	UTSW	17	29842842	splice site	probably null
R7147:Mdga1	UTSW	17	29846521	nonsense	probably null
R7273:Mdga1	UTSW	17	29969938	missense	unknown
R7413:Mdga1	UTSW	17	29850673	missense	probably damaging	1.00
R7637:Mdga1	UTSW	17	29832379	missense	probably benign	0.00
R7797:Mdga1	UTSW	17	29842840	splice site	probably null
R7812:Mdga1	UTSW	17	29843141	missense	probably benign	0.02
R7838:Mdga1	UTSW	17	29839822	missense	probably benign	0.10

Predicted Primers

PCR Primer
(F):5'- CCAGTTCCTGGCAAGTTGTCTACAC -3'
(R):5'- TCTGAATTAAGCCCTGCAAGGCTC -3'

Sequencing Primer
(F):5'- CACAACCAAAACAGTGGTGTTC -3'
(R):5'- TTGGGCTTCACCAGCTAAG -3'

Posted On

2014-04-13