Incidental Mutation 'R1550:Nfasc'
ID169816
Institutional Source Beutler Lab
Gene Symbol Nfasc
Ensembl Gene ENSMUSG00000026442
Gene Nameneurofascin
SynonymsD430023G06Rik
MMRRC Submission 039589-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1550 (G1)
Quality Score202
Status Not validated
Chromosome1
Chromosomal Location132564690-132741797 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 132608503 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 571 (K571E)
Ref Sequence ENSEMBL: ENSMUSP00000092148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043189] [ENSMUST00000094569] [ENSMUST00000163770] [ENSMUST00000187861] [ENSMUST00000188307]
Predicted Effect probably benign
Transcript: ENSMUST00000043189
AA Change: K565E

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000035454
Gene: ENSMUSG00000026442
AA Change: K565E

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 42 131 4.5e0 SMART
IG 141 228 2.44e-7 SMART
IGc2 253 317 1.53e-17 SMART
IGc2 343 409 1.76e-8 SMART
IGc2 437 502 2.39e-10 SMART
IGc2 528 593 2.54e-5 SMART
FN3 607 690 2.17e-11 SMART
FN3 707 789 2.85e-6 SMART
FN3 805 896 2.21e-3 SMART
FN3 911 995 9.92e-6 SMART
low complexity region 996 1018 N/A INTRINSIC
transmembrane domain 1026 1048 N/A INTRINSIC
Pfam:Bravo_FIGEY 1049 1133 1.4e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000094569
AA Change: K571E

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000092148
Gene: ENSMUSG00000026442
AA Change: K571E

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 48 137 4.5e0 SMART
IG 147 234 2.44e-7 SMART
IGc2 259 323 1.53e-17 SMART
IGc2 349 415 1.76e-8 SMART
IGc2 443 508 2.39e-10 SMART
IGc2 534 599 2.54e-5 SMART
FN3 628 711 2.17e-11 SMART
FN3 728 810 2.85e-6 SMART
FN3 825 909 9.92e-6 SMART
FN3 1010 1086 6.91e-5 SMART
transmembrane domain 1109 1131 N/A INTRINSIC
Pfam:Bravo_FIGEY 1132 1216 2.2e-29 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000163770
AA Change: K582E

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000132979
Gene: ENSMUSG00000026442
AA Change: K582E

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 42 131 4.5e0 SMART
IG 141 228 2.44e-7 SMART
IGc2 270 334 1.53e-17 SMART
IGc2 360 426 1.76e-8 SMART
IGc2 454 519 2.39e-10 SMART
IGc2 545 610 2.54e-5 SMART
FN3 624 707 2.17e-11 SMART
FN3 724 806 2.85e-6 SMART
FN3 822 913 2.21e-3 SMART
FN3 928 1012 9.92e-6 SMART
low complexity region 1013 1035 N/A INTRINSIC
transmembrane domain 1043 1065 N/A INTRINSIC
Pfam:Bravo_FIGEY 1066 1150 5e-30 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000186389
AA Change: K551E
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186539
Predicted Effect possibly damaging
Transcript: ENSMUST00000187861
AA Change: K571E

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000139955
Gene: ENSMUSG00000026442
AA Change: K571E

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 48 137 1.8e-2 SMART
IG 147 234 1e-9 SMART
IGc2 259 323 6.4e-20 SMART
IGc2 349 415 7e-11 SMART
IGc2 443 508 9.7e-13 SMART
IGc2 534 599 1.1e-7 SMART
FN3 628 711 1e-13 SMART
FN3 728 810 1.4e-8 SMART
FN3 826 917 1.1e-5 SMART
FN3 932 1016 4.8e-8 SMART
FN3 1117 1193 3.4e-7 SMART
transmembrane domain 1216 1238 N/A INTRINSIC
Pfam:Bravo_FIGEY 1239 1325 2.6e-26 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000188307
AA Change: K565E

PolyPhen 2 Score 0.721 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000139520
Gene: ENSMUSG00000026442
AA Change: K565E

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 42 131 1.8e-2 SMART
IG 141 228 1e-9 SMART
IGc2 253 317 6.4e-20 SMART
IGc2 343 409 7e-11 SMART
IGc2 437 502 9.7e-13 SMART
IGc2 528 593 1.1e-7 SMART
FN3 622 705 1e-13 SMART
FN3 722 804 1.4e-8 SMART
FN3 820 890 3.8e-1 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.4%
  • 20x: 89.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes an L1 family immunoglobulin cell adhesion molecule with multiple IGcam and fibronectin domains. The protein functions in neurite outgrowth, neurite fasciculation, and organization of the axon initial segment (AIS) and nodes of Ranvier on axons during early development. Both the AIS and nodes of Ranvier contain high densities of voltage-gated Na+ (Nav) channels which are clustered by interactions with cytoskeletal and scaffolding proteins including this protein, gliomedin, ankyrin 3 (ankyrin-G), and betaIV spectrin. This protein links the AIS extracellular matrix to the intracellular cytoskeleton. This gene undergoes extensive alternative splicing, and the full-length nature of some variants has not been determined. [provided by RefSeq, May 2009]
PHENOTYPE: Mice homozygous for a null allele die within 6 to 7 days of birth, exhibit reduced nerve conduction velocity and abnormal paranodal junction formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik C A 5: 5,452,019 W144C probably benign Het
Abcc6 A G 7: 46,005,244 V551A probably benign Het
Acss1 A T 2: 150,642,795 L176Q probably damaging Het
Aldh7a1 A G 18: 56,550,382 I117T possibly damaging Het
Arf5 C T 6: 28,426,153 R180C probably damaging Het
Arhgap21 A T 2: 20,881,765 Y39* probably null Het
Arrdc1 A G 2: 24,926,339 L206P probably damaging Het
Cby3 A T 11: 50,359,486 Y173F probably damaging Het
Cdh18 T A 15: 23,436,548 C497S probably damaging Het
Cyp11b2 T C 15: 74,853,593 I226V probably benign Het
Ddit4l T A 3: 137,624,275 probably null Het
Ddx11 C T 17: 66,138,220 T405I probably benign Het
Dhx40 A T 11: 86,776,739 probably null Het
Dlgap2 A G 8: 14,822,499 D659G probably damaging Het
Eef2 A G 10: 81,180,847 E586G probably benign Het
Fam161a A G 11: 23,020,470 Q216R possibly damaging Het
Fbxw24 G T 9: 109,607,044 R307S probably benign Het
Gbp2b G T 3: 142,606,830 A325S probably damaging Het
Gli1 A T 10: 127,338,516 F2Y probably damaging Het
Gm7075 A G 10: 63,421,648 L31P probably damaging Het
Gnl2 T C 4: 125,044,234 V269A probably damaging Het
Grin1 A G 2: 25,305,131 V292A probably benign Het
Heg1 T A 16: 33,735,553 V1001E probably damaging Het
Herc2 T A 7: 56,135,658 I1552N probably damaging Het
Htr1a A G 13: 105,445,280 T343A probably benign Het
Itk G T 11: 46,389,326 R29S probably damaging Het
Ivns1abp G T 1: 151,361,491 G469C probably damaging Het
Jph3 A T 8: 121,784,859 N529Y possibly damaging Het
Kdm2b A G 5: 122,881,057 L829P probably damaging Het
Kprp T A 3: 92,824,726 Y339F probably damaging Het
Lrp2 A G 2: 69,502,661 V1504A possibly damaging Het
Lypd6b A G 2: 49,943,603 D85G probably damaging Het
Mansc4 T C 6: 147,075,638 Y160C probably damaging Het
Mgll C A 6: 88,813,889 H164N probably benign Het
Mtmr4 A T 11: 87,613,516 D1097V probably damaging Het
Nfat5 A T 8: 107,370,573 N1527Y probably damaging Het
Nlgn1 A G 3: 25,912,644 L215P probably damaging Het
Olfr6 T A 7: 106,956,028 I303L probably benign Het
Pde4dip T C 3: 97,719,704 S1173G probably damaging Het
Prrt3 A T 6: 113,495,507 V568E probably damaging Het
Ptpra G A 2: 130,541,393 R503Q possibly damaging Het
Sema5a G A 15: 32,618,849 A508T probably benign Het
Serpinb11 T C 1: 107,379,688 I283T possibly damaging Het
Setbp1 A T 18: 78,858,592 L620Q probably damaging Het
Sipa1l3 A T 7: 29,383,203 C756S probably benign Het
Sirpa A T 2: 129,630,041 I463F probably damaging Het
Slc13a2 G T 11: 78,403,164 N257K probably damaging Het
Slc4a5 C A 6: 83,271,057 T530N probably damaging Het
Stab2 A T 10: 86,878,926 F125L probably benign Het
Tet2 G T 3: 133,469,519 Q1356K probably benign Het
Tet3 A T 6: 83,386,028 S856T probably damaging Het
Tg C T 15: 66,693,430 T1207I possibly damaging Het
Tkt A G 14: 30,565,568 Y173C probably damaging Het
Tlr6 T A 5: 64,953,411 I718F probably damaging Het
Tnfrsf11b A G 15: 54,254,058 V267A possibly damaging Het
Ubqln3 T A 7: 104,141,546 N446Y probably damaging Het
Vmn2r118 C T 17: 55,608,083 C521Y probably damaging Het
Vps16 A G 2: 130,440,340 D394G probably benign Het
Zfp236 A T 18: 82,674,424 M142K possibly damaging Het
Zfp780b T C 7: 27,964,857 D91G probably benign Het
Zfp97 T A 17: 17,145,206 Y322* probably null Het
Other mutations in Nfasc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00895:Nfasc APN 1 132573798 nonsense probably null
IGL01088:Nfasc APN 1 132642776 utr 5 prime probably benign
IGL01958:Nfasc APN 1 132608438 nonsense probably null
IGL01999:Nfasc APN 1 132605247 splice site probably benign
IGL02170:Nfasc APN 1 132610366 nonsense probably null
IGL02187:Nfasc APN 1 132570481 missense probably damaging 1.00
IGL02192:Nfasc APN 1 132570481 missense probably damaging 1.00
IGL02452:Nfasc APN 1 132620924 critical splice donor site probably null
IGL02698:Nfasc APN 1 132634737 missense probably benign 0.06
IGL02797:Nfasc APN 1 132610448 missense probably damaging 1.00
IGL03000:Nfasc APN 1 132621509 splice site probably benign
IGL03027:Nfasc APN 1 132610469 missense probably damaging 1.00
jiggle UTSW 1 132602021 missense probably damaging 1.00
R7838_nfasc_079 UTSW 1 132605549 missense probably damaging 1.00
Tremble UTSW 1 132611595 missense probably damaging 1.00
PIT4377001:Nfasc UTSW 1 132583066 missense unknown
R0240:Nfasc UTSW 1 132601983 missense probably damaging 1.00
R0240:Nfasc UTSW 1 132601983 missense probably damaging 1.00
R0241:Nfasc UTSW 1 132636993 missense probably benign 0.02
R0241:Nfasc UTSW 1 132636993 missense probably benign 0.02
R0418:Nfasc UTSW 1 132611595 missense probably damaging 1.00
R0513:Nfasc UTSW 1 132603846 missense possibly damaging 0.95
R0639:Nfasc UTSW 1 132603816 missense probably damaging 1.00
R0646:Nfasc UTSW 1 132608438 nonsense probably null
R1103:Nfasc UTSW 1 132607057 splice site probably benign
R1269:Nfasc UTSW 1 132610788 missense probably damaging 1.00
R1749:Nfasc UTSW 1 132611632 missense probably damaging 1.00
R1773:Nfasc UTSW 1 132610839 missense probably damaging 1.00
R1921:Nfasc UTSW 1 132610805 missense probably damaging 1.00
R1987:Nfasc UTSW 1 132610886 missense probably damaging 1.00
R2141:Nfasc UTSW 1 132596645 missense probably damaging 1.00
R2239:Nfasc UTSW 1 132583022 intron probably benign
R2413:Nfasc UTSW 1 132595505 missense probably damaging 1.00
R2428:Nfasc UTSW 1 132595654 missense possibly damaging 0.55
R2472:Nfasc UTSW 1 132588221 intron probably benign
R2517:Nfasc UTSW 1 132597763 splice site probably null
R3850:Nfasc UTSW 1 132631733 missense probably damaging 1.00
R4050:Nfasc UTSW 1 132610305 splice site probably benign
R4061:Nfasc UTSW 1 132597845 missense probably damaging 1.00
R4088:Nfasc UTSW 1 132595591 missense probably damaging 1.00
R4342:Nfasc UTSW 1 132631705 missense probably damaging 1.00
R4343:Nfasc UTSW 1 132631705 missense probably damaging 1.00
R4345:Nfasc UTSW 1 132631705 missense probably damaging 1.00
R4452:Nfasc UTSW 1 132634671 missense probably damaging 1.00
R4818:Nfasc UTSW 1 132603830 missense possibly damaging 0.87
R4851:Nfasc UTSW 1 132602021 missense probably damaging 1.00
R5014:Nfasc UTSW 1 132584447 intron probably benign
R5768:Nfasc UTSW 1 132605145 missense probably benign 0.00
R6145:Nfasc UTSW 1 132634717 missense probably damaging 1.00
R6335:Nfasc UTSW 1 132576394 missense probably damaging 0.98
R6379:Nfasc UTSW 1 132570542 nonsense probably null
R6486:Nfasc UTSW 1 132605214 missense probably damaging 1.00
R7022:Nfasc UTSW 1 132621049 missense probably damaging 1.00
R7062:Nfasc UTSW 1 132601969 critical splice donor site probably null
R7084:Nfasc UTSW 1 132570509 missense unknown
R7275:Nfasc UTSW 1 132634263 missense probably damaging 1.00
R7286:Nfasc UTSW 1 132602052 missense probably damaging 1.00
R7682:Nfasc UTSW 1 132573773 missense unknown
R7838:Nfasc UTSW 1 132605549 missense probably damaging 1.00
R7871:Nfasc UTSW 1 132600013 missense not run
R7938:Nfasc UTSW 1 132605531 missense probably damaging 1.00
R8083:Nfasc UTSW 1 132596582 missense probably benign 0.00
R8482:Nfasc UTSW 1 132605089 missense probably damaging 1.00
Z1176:Nfasc UTSW 1 132634638 missense probably benign 0.00
Z1177:Nfasc UTSW 1 132631838 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGAGTGGCAGCTCCTAATCCAG -3'
(R):5'- AAAGGTTCAAAGCCAGGTCCGGTG -3'

Sequencing Primer
(F):5'- ATCGCACCTAAAGGCTGTTG -3'
(R):5'- AGGACTCGGGCATCCAG -3'
Posted On2014-04-13