Incidental Mutation 'R1550:Vps16'
ID 169825
Institutional Source Beutler Lab
Gene Symbol Vps16
Ensembl Gene ENSMUSG00000027411
Gene Name VSP16 CORVET/HOPS core subunit
Synonyms
MMRRC Submission 039589-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.970) question?
Stock # R1550 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 130424339-130444269 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 130440340 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 394 (D394G)
Ref Sequence ENSEMBL: ENSMUSP00000028900 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028900] [ENSMUST00000128994]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000028900
AA Change: D394G

PolyPhen 2 Score 0.088 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000028900
Gene: ENSMUSG00000027411
AA Change: D394G

DomainStartEndE-ValueType
Pfam:Vps16_N 4 420 1e-166 PFAM
low complexity region 452 462 N/A INTRINSIC
Pfam:Vps16_C 517 835 5.5e-150 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125098
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125973
Predicted Effect probably benign
Transcript: ENSMUST00000128994
SMART Domains Protein: ENSMUSP00000115899
Gene: ENSMUSG00000027411

DomainStartEndE-ValueType
Pfam:Vps16_N 4 212 3.2e-74 PFAM
Pfam:Vps16_N 205 316 1e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130258
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131220
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132388
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134677
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137084
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.4%
  • 20x: 89.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Vesicle mediated protein sorting plays an important role in segregation of intracellular molecules into distinct organelles. Genetic studies in yeast have identified more than 40 vacuolar protein sorting (VPS) genes involved in vesicle transport to vacuoles. This gene encodes the human homolog of yeast class C Vps16 protein. The mammalian class C Vps proteins are predominantly associated with late endosomes/lysosomes, and like their yeast counterparts, may mediate vesicle trafficking steps in the endosome/lysosome pathway. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2009]
PHENOTYPE: Mice with a homozygous point mutation in exon 3 display impaired motor function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik C A 5: 5,452,019 W144C probably benign Het
Abcc6 A G 7: 46,005,244 V551A probably benign Het
Acss1 A T 2: 150,642,795 L176Q probably damaging Het
Aldh7a1 A G 18: 56,550,382 I117T possibly damaging Het
Arf5 C T 6: 28,426,153 R180C probably damaging Het
Arhgap21 A T 2: 20,881,765 Y39* probably null Het
Arrdc1 A G 2: 24,926,339 L206P probably damaging Het
Cby3 A T 11: 50,359,486 Y173F probably damaging Het
Cdh18 T A 15: 23,436,548 C497S probably damaging Het
Cyp11b2 T C 15: 74,853,593 I226V probably benign Het
Ddit4l T A 3: 137,624,275 probably null Het
Ddx11 C T 17: 66,138,220 T405I probably benign Het
Dhx40 A T 11: 86,776,739 probably null Het
Dlgap2 A G 8: 14,822,499 D659G probably damaging Het
Eef2 A G 10: 81,180,847 E586G probably benign Het
Fam161a A G 11: 23,020,470 Q216R possibly damaging Het
Fbxw24 G T 9: 109,607,044 R307S probably benign Het
Gbp2b G T 3: 142,606,830 A325S probably damaging Het
Gli1 A T 10: 127,338,516 F2Y probably damaging Het
Gm7075 A G 10: 63,421,648 L31P probably damaging Het
Gnl2 T C 4: 125,044,234 V269A probably damaging Het
Grin1 A G 2: 25,305,131 V292A probably benign Het
Heg1 T A 16: 33,735,553 V1001E probably damaging Het
Herc2 T A 7: 56,135,658 I1552N probably damaging Het
Htr1a A G 13: 105,445,280 T343A probably benign Het
Itk G T 11: 46,389,326 R29S probably damaging Het
Ivns1abp G T 1: 151,361,491 G469C probably damaging Het
Jph3 A T 8: 121,784,859 N529Y possibly damaging Het
Kdm2b A G 5: 122,881,057 L829P probably damaging Het
Kprp T A 3: 92,824,726 Y339F probably damaging Het
Lrp2 A G 2: 69,502,661 V1504A possibly damaging Het
Lypd6b A G 2: 49,943,603 D85G probably damaging Het
Mansc4 T C 6: 147,075,638 Y160C probably damaging Het
Mgll C A 6: 88,813,889 H164N probably benign Het
Mtmr4 A T 11: 87,613,516 D1097V probably damaging Het
Nfasc T C 1: 132,608,503 K571E probably damaging Het
Nfat5 A T 8: 107,370,573 N1527Y probably damaging Het
Nlgn1 A G 3: 25,912,644 L215P probably damaging Het
Olfr6 T A 7: 106,956,028 I303L probably benign Het
Pde4dip T C 3: 97,719,704 S1173G probably damaging Het
Prrt3 A T 6: 113,495,507 V568E probably damaging Het
Ptpra G A 2: 130,541,393 R503Q possibly damaging Het
Sema5a G A 15: 32,618,849 A508T probably benign Het
Serpinb11 T C 1: 107,379,688 I283T possibly damaging Het
Setbp1 A T 18: 78,858,592 L620Q probably damaging Het
Sipa1l3 A T 7: 29,383,203 C756S probably benign Het
Sirpa A T 2: 129,630,041 I463F probably damaging Het
Slc13a2 G T 11: 78,403,164 N257K probably damaging Het
Slc4a5 C A 6: 83,271,057 T530N probably damaging Het
Stab2 A T 10: 86,878,926 F125L probably benign Het
Tet2 G T 3: 133,469,519 Q1356K probably benign Het
Tet3 A T 6: 83,386,028 S856T probably damaging Het
Tg C T 15: 66,693,430 T1207I possibly damaging Het
Tkt A G 14: 30,565,568 Y173C probably damaging Het
Tlr6 T A 5: 64,953,411 I718F probably damaging Het
Tnfrsf11b A G 15: 54,254,058 V267A possibly damaging Het
Ubqln3 T A 7: 104,141,546 N446Y probably damaging Het
Vmn2r118 C T 17: 55,608,083 C521Y probably damaging Het
Zfp236 A T 18: 82,674,424 M142K possibly damaging Het
Zfp780b T C 7: 27,964,857 D91G probably benign Het
Zfp97 T A 17: 17,145,206 Y322* probably null Het
Other mutations in Vps16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:Vps16 APN 2 130437696 missense probably benign 0.19
IGL01400:Vps16 APN 2 130438353 missense possibly damaging 0.73
IGL01542:Vps16 APN 2 130438394 missense probably damaging 0.97
IGL02011:Vps16 APN 2 130441479 missense probably benign 0.04
IGL02192:Vps16 APN 2 130440932 missense probably damaging 0.98
IGL02220:Vps16 APN 2 130441653 missense possibly damaging 0.85
IGL02587:Vps16 APN 2 130439716 critical splice donor site probably null
R0427:Vps16 UTSW 2 130438850 missense probably benign 0.00
R0507:Vps16 UTSW 2 130437712 critical splice donor site probably null
R1789:Vps16 UTSW 2 130443600 missense probably benign 0.42
R3895:Vps16 UTSW 2 130438676 missense possibly damaging 0.96
R3981:Vps16 UTSW 2 130442594 missense possibly damaging 0.77
R4092:Vps16 UTSW 2 130439912 missense probably damaging 1.00
R4555:Vps16 UTSW 2 130443576 missense probably damaging 1.00
R4569:Vps16 UTSW 2 130442204 missense probably benign
R4803:Vps16 UTSW 2 130438110 missense probably benign 0.27
R4835:Vps16 UTSW 2 130438300 splice site probably benign
R5022:Vps16 UTSW 2 130439452 missense probably benign 0.07
R5023:Vps16 UTSW 2 130439452 missense probably benign 0.07
R5057:Vps16 UTSW 2 130439452 missense probably benign 0.07
R5158:Vps16 UTSW 2 130441279 missense probably damaging 1.00
R5177:Vps16 UTSW 2 130443368 nonsense probably null
R5540:Vps16 UTSW 2 130442385 missense probably benign 0.00
R5680:Vps16 UTSW 2 130440324 missense possibly damaging 0.64
R5689:Vps16 UTSW 2 130439091 nonsense probably null
R5690:Vps16 UTSW 2 130439091 nonsense probably null
R5926:Vps16 UTSW 2 130443556 missense probably damaging 0.97
R5992:Vps16 UTSW 2 130424449 critical splice donor site probably null
R6135:Vps16 UTSW 2 130438653 missense possibly damaging 0.57
R6370:Vps16 UTSW 2 130443384 missense probably damaging 1.00
R6898:Vps16 UTSW 2 130437681 missense possibly damaging 0.74
R7378:Vps16 UTSW 2 130438179 missense probably damaging 1.00
R7487:Vps16 UTSW 2 130439057 nonsense probably null
R7641:Vps16 UTSW 2 130440528 missense probably benign 0.28
R7720:Vps16 UTSW 2 130441703 nonsense probably null
R8246:Vps16 UTSW 2 130438873 missense probably damaging 1.00
R8363:Vps16 UTSW 2 130442241 missense probably benign 0.08
R9092:Vps16 UTSW 2 130439673 missense probably damaging 0.99
R9128:Vps16 UTSW 2 130424399 missense possibly damaging 0.51
R9352:Vps16 UTSW 2 130441903 critical splice donor site probably null
R9406:Vps16 UTSW 2 130441505 critical splice donor site probably null
R9508:Vps16 UTSW 2 130442441 missense possibly damaging 0.94
R9800:Vps16 UTSW 2 130440485 missense probably benign 0.02
RF021:Vps16 UTSW 2 130438209 missense probably benign 0.09
Z1177:Vps16 UTSW 2 130441426 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACCCTACTGTCCACAGGCTCAAG -3'
(R):5'- GCACGAAGCTGTCAGGTGGAAATC -3'

Sequencing Primer
(F):5'- CAAGTTGGTGCTTTCCAAGAC -3'
(R):5'- CTGTCAGGTGGAAATCTGTCAAG -3'
Posted On 2014-04-13