Incidental Mutation 'R1550:Prrt3'
ID169843
Institutional Source Beutler Lab
Gene Symbol Prrt3
Ensembl Gene ENSMUSG00000045009
Gene Nameproline-rich transmembrane protein 3
SynonymsB230206N24Rik
MMRRC Submission 039589-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R1550 (G1)
Quality Score212
Status Not validated
Chromosome6
Chromosomal Location113493639-113501931 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 113495507 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 568 (V568E)
Ref Sequence ENSEMBL: ENSMUSP00000145443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032422] [ENSMUST00000101059] [ENSMUST00000204134] [ENSMUST00000204268] [ENSMUST00000205075] [ENSMUST00000205170]
Predicted Effect probably benign
Transcript: ENSMUST00000032422
SMART Domains Protein: ENSMUSP00000032422
Gene: ENSMUSG00000030284

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:DUF3456 45 103 1.7e-9 PFAM
EGF 154 193 2.11e1 SMART
FU 208 255 1.66e-1 SMART
EGF 213 244 2.2e1 SMART
EGF_like 245 290 4.26e-3 SMART
FU 268 315 4.46e-2 SMART
EGF_CA 305 344 1.1e-7 SMART
transmembrane domain 363 382 N/A INTRINSIC
transmembrane domain 387 406 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000101059
AA Change: V567E

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000098620
Gene: ENSMUSG00000045009
AA Change: V567E

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 99 111 N/A INTRINSIC
low complexity region 125 136 N/A INTRINSIC
low complexity region 142 162 N/A INTRINSIC
low complexity region 239 252 N/A INTRINSIC
low complexity region 270 281 N/A INTRINSIC
low complexity region 307 321 N/A INTRINSIC
low complexity region 423 447 N/A INTRINSIC
transmembrane domain 463 485 N/A INTRINSIC
transmembrane domain 492 511 N/A INTRINSIC
transmembrane domain 526 548 N/A INTRINSIC
transmembrane domain 561 583 N/A INTRINSIC
transmembrane domain 588 610 N/A INTRINSIC
transmembrane domain 630 652 N/A INTRINSIC
transmembrane domain 667 689 N/A INTRINSIC
low complexity region 885 905 N/A INTRINSIC
low complexity region 927 943 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129125
Predicted Effect probably damaging
Transcript: ENSMUST00000204134
AA Change: V568E

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000145031
Gene: ENSMUSG00000045009
AA Change: V568E

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 99 111 N/A INTRINSIC
low complexity region 125 136 N/A INTRINSIC
low complexity region 142 162 N/A INTRINSIC
low complexity region 239 252 N/A INTRINSIC
low complexity region 270 281 N/A INTRINSIC
low complexity region 307 321 N/A INTRINSIC
low complexity region 424 448 N/A INTRINSIC
transmembrane domain 464 486 N/A INTRINSIC
transmembrane domain 493 512 N/A INTRINSIC
transmembrane domain 527 549 N/A INTRINSIC
transmembrane domain 562 584 N/A INTRINSIC
transmembrane domain 589 611 N/A INTRINSIC
transmembrane domain 631 653 N/A INTRINSIC
transmembrane domain 668 690 N/A INTRINSIC
low complexity region 886 906 N/A INTRINSIC
low complexity region 928 944 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000204268
AA Change: V568E

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000145443
Gene: ENSMUSG00000045009
AA Change: V568E

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 99 111 N/A INTRINSIC
low complexity region 125 136 N/A INTRINSIC
low complexity region 142 162 N/A INTRINSIC
low complexity region 239 252 N/A INTRINSIC
low complexity region 270 281 N/A INTRINSIC
low complexity region 307 321 N/A INTRINSIC
low complexity region 424 448 N/A INTRINSIC
transmembrane domain 464 486 N/A INTRINSIC
transmembrane domain 493 512 N/A INTRINSIC
transmembrane domain 527 549 N/A INTRINSIC
transmembrane domain 562 584 N/A INTRINSIC
transmembrane domain 589 611 N/A INTRINSIC
transmembrane domain 631 653 N/A INTRINSIC
transmembrane domain 668 690 N/A INTRINSIC
low complexity region 886 906 N/A INTRINSIC
low complexity region 928 944 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204920
Predicted Effect probably benign
Transcript: ENSMUST00000205075
SMART Domains Protein: ENSMUSP00000145089
Gene: ENSMUSG00000045009

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 99 111 N/A INTRINSIC
low complexity region 125 136 N/A INTRINSIC
low complexity region 142 162 N/A INTRINSIC
low complexity region 239 252 N/A INTRINSIC
low complexity region 270 281 N/A INTRINSIC
low complexity region 307 321 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205170
SMART Domains Protein: ENSMUSP00000145183
Gene: ENSMUSG00000045009

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 99 111 N/A INTRINSIC
low complexity region 125 136 N/A INTRINSIC
low complexity region 142 162 N/A INTRINSIC
low complexity region 239 252 N/A INTRINSIC
low complexity region 270 281 N/A INTRINSIC
low complexity region 307 321 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.4%
  • 20x: 89.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik C A 5: 5,452,019 W144C probably benign Het
Abcc6 A G 7: 46,005,244 V551A probably benign Het
Acss1 A T 2: 150,642,795 L176Q probably damaging Het
Aldh7a1 A G 18: 56,550,382 I117T possibly damaging Het
Arf5 C T 6: 28,426,153 R180C probably damaging Het
Arhgap21 A T 2: 20,881,765 Y39* probably null Het
Arrdc1 A G 2: 24,926,339 L206P probably damaging Het
Cby3 A T 11: 50,359,486 Y173F probably damaging Het
Cdh18 T A 15: 23,436,548 C497S probably damaging Het
Cyp11b2 T C 15: 74,853,593 I226V probably benign Het
Ddit4l T A 3: 137,624,275 probably null Het
Ddx11 C T 17: 66,138,220 T405I probably benign Het
Dhx40 A T 11: 86,776,739 probably null Het
Dlgap2 A G 8: 14,822,499 D659G probably damaging Het
Eef2 A G 10: 81,180,847 E586G probably benign Het
Fam161a A G 11: 23,020,470 Q216R possibly damaging Het
Fbxw24 G T 9: 109,607,044 R307S probably benign Het
Gbp2b G T 3: 142,606,830 A325S probably damaging Het
Gli1 A T 10: 127,338,516 F2Y probably damaging Het
Gm7075 A G 10: 63,421,648 L31P probably damaging Het
Gnl2 T C 4: 125,044,234 V269A probably damaging Het
Grin1 A G 2: 25,305,131 V292A probably benign Het
Heg1 T A 16: 33,735,553 V1001E probably damaging Het
Herc2 T A 7: 56,135,658 I1552N probably damaging Het
Htr1a A G 13: 105,445,280 T343A probably benign Het
Itk G T 11: 46,389,326 R29S probably damaging Het
Ivns1abp G T 1: 151,361,491 G469C probably damaging Het
Jph3 A T 8: 121,784,859 N529Y possibly damaging Het
Kdm2b A G 5: 122,881,057 L829P probably damaging Het
Kprp T A 3: 92,824,726 Y339F probably damaging Het
Lrp2 A G 2: 69,502,661 V1504A possibly damaging Het
Lypd6b A G 2: 49,943,603 D85G probably damaging Het
Mansc4 T C 6: 147,075,638 Y160C probably damaging Het
Mgll C A 6: 88,813,889 H164N probably benign Het
Mtmr4 A T 11: 87,613,516 D1097V probably damaging Het
Nfasc T C 1: 132,608,503 K571E probably damaging Het
Nfat5 A T 8: 107,370,573 N1527Y probably damaging Het
Nlgn1 A G 3: 25,912,644 L215P probably damaging Het
Olfr6 T A 7: 106,956,028 I303L probably benign Het
Pde4dip T C 3: 97,719,704 S1173G probably damaging Het
Ptpra G A 2: 130,541,393 R503Q possibly damaging Het
Sema5a G A 15: 32,618,849 A508T probably benign Het
Serpinb11 T C 1: 107,379,688 I283T possibly damaging Het
Setbp1 A T 18: 78,858,592 L620Q probably damaging Het
Sipa1l3 A T 7: 29,383,203 C756S probably benign Het
Sirpa A T 2: 129,630,041 I463F probably damaging Het
Slc13a2 G T 11: 78,403,164 N257K probably damaging Het
Slc4a5 C A 6: 83,271,057 T530N probably damaging Het
Stab2 A T 10: 86,878,926 F125L probably benign Het
Tet2 G T 3: 133,469,519 Q1356K probably benign Het
Tet3 A T 6: 83,386,028 S856T probably damaging Het
Tg C T 15: 66,693,430 T1207I possibly damaging Het
Tkt A G 14: 30,565,568 Y173C probably damaging Het
Tlr6 T A 5: 64,953,411 I718F probably damaging Het
Tnfrsf11b A G 15: 54,254,058 V267A possibly damaging Het
Ubqln3 T A 7: 104,141,546 N446Y probably damaging Het
Vmn2r118 C T 17: 55,608,083 C521Y probably damaging Het
Vps16 A G 2: 130,440,340 D394G probably benign Het
Zfp236 A T 18: 82,674,424 M142K possibly damaging Het
Zfp780b T C 7: 27,964,857 D91G probably benign Het
Zfp97 T A 17: 17,145,206 Y322* probably null Het
Other mutations in Prrt3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01061:Prrt3 APN 6 113497770 missense possibly damaging 0.66
IGL02199:Prrt3 APN 6 113494809 missense probably damaging 1.00
IGL02441:Prrt3 APN 6 113497016 missense probably damaging 0.99
IGL02498:Prrt3 APN 6 113497827 missense possibly damaging 0.62
IGL02508:Prrt3 APN 6 113494307 missense probably damaging 1.00
IGL03231:Prrt3 APN 6 113497524 missense possibly damaging 0.83
R0102:Prrt3 UTSW 6 113497829 missense probably damaging 0.97
R0102:Prrt3 UTSW 6 113497829 missense probably damaging 0.97
R0207:Prrt3 UTSW 6 113495840 missense probably damaging 1.00
R1005:Prrt3 UTSW 6 113494778 missense probably damaging 1.00
R4036:Prrt3 UTSW 6 113497680 frame shift probably null
R4393:Prrt3 UTSW 6 113494946 missense probably benign
R4604:Prrt3 UTSW 6 113498237 missense possibly damaging 0.83
R4825:Prrt3 UTSW 6 113498138 missense probably benign 0.01
R5155:Prrt3 UTSW 6 113497559 splice site probably null
R6154:Prrt3 UTSW 6 113495028 missense probably damaging 1.00
R7570:Prrt3 UTSW 6 113494488 missense probably damaging 0.98
Z1177:Prrt3 UTSW 6 113497302 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CCGCATAGCAGTTATTGGGTCTCTC -3'
(R):5'- TGCGATCTGCCTACATGCTCAC -3'

Sequencing Primer
(F):5'- AGTGCCCAGGTCAATTCCAG -3'
(R):5'- TGGTGCTATACAACTTGCCC -3'
Posted On2014-04-13