Mutagenetix > Incidental Mutation

Incidental Mutation 'R1550:Abcc6'

169848

Institutional Source

Beutler Lab

Gene Symbol

Abcc6

Ensembl Gene

ENSMUSG00000030834

Gene Name

ATP-binding cassette, sub-family C (CFTR/MRP), member 6

Synonyms

Mrp6, DCC, Dyscalc1

MMRRC Submission

039589-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.874) question?

Stock #

R1550 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

45967555-46030302 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 46005244 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 551 (V551A)

Ref Sequence

ENSEMBL: ENSMUSP00000002850 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000002850]

AlphaFold

Q9R1S7

Predicted Effect

probably benign
Transcript: ENSMUST00000002850
AA Change: V551A

PolyPhen 2 Score 0.253 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000002850
Gene: ENSMUSG00000030834
AA Change: V551A

Domain	Start	End	E-Value	Type
transmembrane domain	44	61	N/A	INTRINSIC
transmembrane domain	81	100	N/A	INTRINSIC
transmembrane domain	110	129	N/A	INTRINSIC
transmembrane domain	142	161	N/A	INTRINSIC
transmembrane domain	171	193	N/A	INTRINSIC
Pfam:ABC_membrane	309	580	3.5e-29	PFAM
AAA	653	828	1.19e-9	SMART
low complexity region	871	885	N/A	INTRINSIC
Pfam:ABC_membrane	942	1211	2.5e-32	PFAM
AAA	1286	1473	1.71e-10	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000211780

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.4%
20x: 89.2%

Validation Efficiency

MGI Phenotype

FUNCTION: The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. The specific function of this protein is unknown; however, a similar rat protein has been identified as the major canalicular bile salt export pump of liver. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display patchy mineralization which may include the capsule surrounding the sinuses of vibrissae, medium sized arteries, skin, retina, kidney, and interscapular brown fat. Strain differences at this locus may lead to altered susceptibility to cardiac calcinosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700015F17Rik	C	A	5: 5,452,019	W144C	probably benign	Het
Acss1	A	T	2: 150,642,795	L176Q	probably damaging	Het
Aldh7a1	A	G	18: 56,550,382	I117T	possibly damaging	Het
Arf5	C	T	6: 28,426,153	R180C	probably damaging	Het
Arhgap21	A	T	2: 20,881,765	Y39*	probably null	Het
Arrdc1	A	G	2: 24,926,339	L206P	probably damaging	Het
Cby3	A	T	11: 50,359,486	Y173F	probably damaging	Het
Cdh18	T	A	15: 23,436,548	C497S	probably damaging	Het
Cyp11b2	T	C	15: 74,853,593	I226V	probably benign	Het
Ddit4l	T	A	3: 137,624,275		probably null	Het
Ddx11	C	T	17: 66,138,220	T405I	probably benign	Het
Dhx40	A	T	11: 86,776,739		probably null	Het
Dlgap2	A	G	8: 14,822,499	D659G	probably damaging	Het
Eef2	A	G	10: 81,180,847	E586G	probably benign	Het
Fam161a	A	G	11: 23,020,470	Q216R	possibly damaging	Het
Fbxw24	G	T	9: 109,607,044	R307S	probably benign	Het
Gbp2b	G	T	3: 142,606,830	A325S	probably damaging	Het
Gli1	A	T	10: 127,338,516	F2Y	probably damaging	Het
Gm7075	A	G	10: 63,421,648	L31P	probably damaging	Het
Gnl2	T	C	4: 125,044,234	V269A	probably damaging	Het
Grin1	A	G	2: 25,305,131	V292A	probably benign	Het
Heg1	T	A	16: 33,735,553	V1001E	probably damaging	Het
Herc2	T	A	7: 56,135,658	I1552N	probably damaging	Het
Htr1a	A	G	13: 105,445,280	T343A	probably benign	Het
Itk	G	T	11: 46,389,326	R29S	probably damaging	Het
Ivns1abp	G	T	1: 151,361,491	G469C	probably damaging	Het
Jph3	A	T	8: 121,784,859	N529Y	possibly damaging	Het
Kdm2b	A	G	5: 122,881,057	L829P	probably damaging	Het
Kprp	T	A	3: 92,824,726	Y339F	probably damaging	Het
Lrp2	A	G	2: 69,502,661	V1504A	possibly damaging	Het
Lypd6b	A	G	2: 49,943,603	D85G	probably damaging	Het
Mansc4	T	C	6: 147,075,638	Y160C	probably damaging	Het
Mgll	C	A	6: 88,813,889	H164N	probably benign	Het
Mtmr4	A	T	11: 87,613,516	D1097V	probably damaging	Het
Nfasc	T	C	1: 132,608,503	K571E	probably damaging	Het
Nfat5	A	T	8: 107,370,573	N1527Y	probably damaging	Het
Nlgn1	A	G	3: 25,912,644	L215P	probably damaging	Het
Olfr6	T	A	7: 106,956,028	I303L	probably benign	Het
Pde4dip	T	C	3: 97,719,704	S1173G	probably damaging	Het
Prrt3	A	T	6: 113,495,507	V568E	probably damaging	Het
Ptpra	G	A	2: 130,541,393	R503Q	possibly damaging	Het
Sema5a	G	A	15: 32,618,849	A508T	probably benign	Het
Serpinb11	T	C	1: 107,379,688	I283T	possibly damaging	Het
Setbp1	A	T	18: 78,858,592	L620Q	probably damaging	Het
Sipa1l3	A	T	7: 29,383,203	C756S	probably benign	Het
Sirpa	A	T	2: 129,630,041	I463F	probably damaging	Het
Slc13a2	G	T	11: 78,403,164	N257K	probably damaging	Het
Slc4a5	C	A	6: 83,271,057	T530N	probably damaging	Het
Stab2	A	T	10: 86,878,926	F125L	probably benign	Het
Tet2	G	T	3: 133,469,519	Q1356K	probably benign	Het
Tet3	A	T	6: 83,386,028	S856T	probably damaging	Het
Tg	C	T	15: 66,693,430	T1207I	possibly damaging	Het
Tkt	A	G	14: 30,565,568	Y173C	probably damaging	Het
Tlr6	T	A	5: 64,953,411	I718F	probably damaging	Het
Tnfrsf11b	A	G	15: 54,254,058	V267A	possibly damaging	Het
Ubqln3	T	A	7: 104,141,546	N446Y	probably damaging	Het
Vmn2r118	C	T	17: 55,608,083	C521Y	probably damaging	Het
Vps16	A	G	2: 130,440,340	D394G	probably benign	Het
Zfp236	A	T	18: 82,674,424	M142K	possibly damaging	Het
Zfp780b	T	C	7: 27,964,857	D91G	probably benign	Het
Zfp97	T	A	17: 17,145,206	Y322*	probably null	Het

Other mutations in Abcc6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01589:Abcc6	APN	7	46002672	splice site	probably benign
IGL01731:Abcc6	APN	7	46002610	missense	possibly damaging	0.71
IGL01743:Abcc6	APN	7	45996814	missense	probably benign	0.02
IGL01757:Abcc6	APN	7	45990281	splice site	probably benign
IGL01895:Abcc6	APN	7	46029058	missense	possibly damaging	0.88
IGL01942:Abcc6	APN	7	45986573	missense	possibly damaging	0.89
IGL02251:Abcc6	APN	7	45977416	missense	probably damaging	1.00
IGL02277:Abcc6	APN	7	46001061	missense	probably benign	0.00
IGL02548:Abcc6	APN	7	46005262	missense	probably damaging	0.98
IGL03063:Abcc6	APN	7	46016432	missense	probably benign
IGL03092:Abcc6	APN	7	45986470	missense	probably damaging	1.00
IGL03251:Abcc6	APN	7	45982237	unclassified	probably benign
R0057:Abcc6	UTSW	7	46020143	missense	probably benign	0.03
R0944:Abcc6	UTSW	7	46015505	missense	possibly damaging	0.81
R1019:Abcc6	UTSW	7	46014107	missense	possibly damaging	0.77
R1183:Abcc6	UTSW	7	45985253	missense	probably damaging	0.99
R1543:Abcc6	UTSW	7	46016504	missense	probably benign	0.01
R1725:Abcc6	UTSW	7	45992357	missense	possibly damaging	0.76
R1907:Abcc6	UTSW	7	46014169	missense	probably benign	0.04
R1908:Abcc6	UTSW	7	46020134	splice site	probably null
R1909:Abcc6	UTSW	7	46020134	splice site	probably null
R2138:Abcc6	UTSW	7	45981051	missense	probably damaging	1.00
R2145:Abcc6	UTSW	7	45998741	missense	probably benign	0.01
R2402:Abcc6	UTSW	7	46015575	missense	probably benign	0.04
R3983:Abcc6	UTSW	7	45995289	missense	probably benign
R4013:Abcc6	UTSW	7	46018680	missense	probably benign	0.01
R4051:Abcc6	UTSW	7	45986563	missense	probably damaging	1.00
R4052:Abcc6	UTSW	7	45986563	missense	probably damaging	1.00
R4208:Abcc6	UTSW	7	45986563	missense	probably damaging	1.00
R4362:Abcc6	UTSW	7	45998832	splice site	probably benign
R4385:Abcc6	UTSW	7	45995328	missense	possibly damaging	0.93
R4399:Abcc6	UTSW	7	46002607	missense	probably benign
R4479:Abcc6	UTSW	7	46005239	missense	possibly damaging	0.60
R4480:Abcc6	UTSW	7	46005239	missense	possibly damaging	0.60
R4780:Abcc6	UTSW	7	45996691	missense	probably benign
R4791:Abcc6	UTSW	7	45982160	missense	probably benign	0.00
R4895:Abcc6	UTSW	7	45980990	missense	possibly damaging	0.95
R4898:Abcc6	UTSW	7	45989687	missense	probably damaging	0.96
R4905:Abcc6	UTSW	7	45995225	missense	probably benign
R4941:Abcc6	UTSW	7	46012523	missense	probably benign	0.00
R5040:Abcc6	UTSW	7	46020154	missense	probably benign	0.04
R5128:Abcc6	UTSW	7	45989646	missense	probably benign	0.00
R5284:Abcc6	UTSW	7	45981059	missense	probably benign	0.05
R5328:Abcc6	UTSW	7	45992311	missense	probably benign	0.01
R5459:Abcc6	UTSW	7	45982183	missense	probably benign	0.00
R5543:Abcc6	UTSW	7	45989536	critical splice donor site	probably null
R6178:Abcc6	UTSW	7	46029044	missense	probably benign
R6228:Abcc6	UTSW	7	46030256	missense	probably benign	0.02
R6532:Abcc6	UTSW	7	45977379	missense	probably damaging	1.00
R6605:Abcc6	UTSW	7	45981057	missense	probably damaging	1.00
R7000:Abcc6	UTSW	7	46005522	missense	possibly damaging	0.60
R7067:Abcc6	UTSW	7	46018690	missense	probably benign
R7553:Abcc6	UTSW	7	45999121	missense	probably damaging	1.00
R7597:Abcc6	UTSW	7	45995237	missense	probably damaging	1.00
R7718:Abcc6	UTSW	7	45977392	missense	possibly damaging	0.91
R7781:Abcc6	UTSW	7	46005606	missense	probably damaging	1.00
R7798:Abcc6	UTSW	7	45976853	nonsense	probably null
R7896:Abcc6	UTSW	7	45977379	missense	probably damaging	1.00
R8098:Abcc6	UTSW	7	45996665	missense	probably damaging	1.00
R8443:Abcc6	UTSW	7	45980025	missense	probably damaging	1.00
R8773:Abcc6	UTSW	7	45985145	missense	probably benign
R8784:Abcc6	UTSW	7	46002601	missense	probably benign
R8802:Abcc6	UTSW	7	46008859	missense	probably damaging	0.99
R8807:Abcc6	UTSW	7	45999007	missense	possibly damaging	0.67
R9006:Abcc6	UTSW	7	46016396	missense	probably benign	0.00
R9127:Abcc6	UTSW	7	45979760	missense	probably damaging	1.00
R9475:Abcc6	UTSW	7	46016468	missense	probably damaging	1.00
R9480:Abcc6	UTSW	7	45979773	missense	probably damaging	1.00
R9535:Abcc6	UTSW	7	45977263	missense	probably damaging	1.00
R9642:Abcc6	UTSW	7	45990341	missense	probably benign	0.07
R9715:Abcc6	UTSW	7	45979935	missense	probably damaging	1.00
R9731:Abcc6	UTSW	7	46020236	nonsense	probably null
X0065:Abcc6	UTSW	7	46020197	missense	probably damaging	0.99
Z1176:Abcc6	UTSW	7	45979734	missense	probably damaging	1.00
Z1176:Abcc6	UTSW	7	45992306	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- TCTCTAGGATGCTTGCTGAGGCTC -3'
(R):5'- CTCCATGCTCAGAACTGTGAGAACC -3'

Sequencing Primer
(F):5'- GACCCACTTCTGATGGTCTGG -3'
(R):5'- CAAGTGTCTACATTTCTGGTGAC -3'

Posted On

2014-04-13