Incidental Mutation 'R1550:Ubqln3'
ID 169851
Institutional Source Beutler Lab
Gene Symbol Ubqln3
Ensembl Gene ENSMUSG00000051618
Gene Name ubiquilin 3
Synonyms 4933400K24Rik
MMRRC Submission 039589-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.092) question?
Stock # R1550 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 103789830-103792486 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 103790753 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Tyrosine at position 446 (N446Y)
Ref Sequence ENSEMBL: ENSMUSP00000055229 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057254] [ENSMUST00000138055]
AlphaFold Q8C5U9
Predicted Effect probably damaging
Transcript: ENSMUST00000057254
AA Change: N446Y

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000055229
Gene: ENSMUSG00000051618
AA Change: N446Y

DomainStartEndE-ValueType
UBQ 22 92 1.56e-15 SMART
low complexity region 103 115 N/A INTRINSIC
low complexity region 120 151 N/A INTRINSIC
STI1 194 233 4.25e-7 SMART
low complexity region 280 291 N/A INTRINSIC
low complexity region 313 328 N/A INTRINSIC
low complexity region 505 515 N/A INTRINSIC
UBA 619 657 4.22e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138055
SMART Domains Protein: ENSMUSP00000139240
Gene: ENSMUSG00000109824

DomainStartEndE-ValueType
transmembrane domain 29 51 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.4%
  • 20x: 89.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitin-like protein (ubiquilin) that shares a high degree of similarity with related products in yeast, rat and frog. Ubiquilins contain an N-terminal ubiquitin-like domain and a C-terminal ubiquitin-associated domain. They physically associate with both proteasomes and ubiquitin ligases, and are thus thought to functionally link the ubiquitination machinery to the proteasome to affect in vivo protein degradation. This gene is specifically expressed in the testis. It has been suggested that this gene may regulate cell-cycle progression during spermatogenesis, however, it has been shown that the ortholgous mouse gene is dispensable for embryonic development and spermatogenesis. [provided by RefSeq, Nov 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and developmentally normal with no apparent defects in male fertility or spermatogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 A G 7: 45,654,668 (GRCm39) V551A probably benign Het
Acss1 A T 2: 150,484,715 (GRCm39) L176Q probably damaging Het
Aldh7a1 A G 18: 56,683,454 (GRCm39) I117T possibly damaging Het
Arf5 C T 6: 28,426,152 (GRCm39) R180C probably damaging Het
Arhgap21 A T 2: 20,886,576 (GRCm39) Y39* probably null Het
Arrdc1 A G 2: 24,816,351 (GRCm39) L206P probably damaging Het
Cby3 A T 11: 50,250,313 (GRCm39) Y173F probably damaging Het
Cdh18 T A 15: 23,436,634 (GRCm39) C497S probably damaging Het
Cyp11b2 T C 15: 74,725,442 (GRCm39) I226V probably benign Het
Ddit4l T A 3: 137,330,036 (GRCm39) probably null Het
Ddx11 C T 17: 66,445,215 (GRCm39) T405I probably benign Het
Dhx40 A T 11: 86,667,565 (GRCm39) probably null Het
Dlgap2 A G 8: 14,872,499 (GRCm39) D659G probably damaging Het
Eef2 A G 10: 81,016,681 (GRCm39) E586G probably benign Het
Fam161a A G 11: 22,970,470 (GRCm39) Q216R possibly damaging Het
Fbxw24 G T 9: 109,436,112 (GRCm39) R307S probably benign Het
Gbp2b G T 3: 142,312,591 (GRCm39) A325S probably damaging Het
Gli1 A T 10: 127,174,385 (GRCm39) F2Y probably damaging Het
Gnl2 T C 4: 124,938,027 (GRCm39) V269A probably damaging Het
Grin1 A G 2: 25,195,143 (GRCm39) V292A probably benign Het
Heg1 T A 16: 33,555,923 (GRCm39) V1001E probably damaging Het
Herc2 T A 7: 55,785,406 (GRCm39) I1552N probably damaging Het
Htr1a A G 13: 105,581,788 (GRCm39) T343A probably benign Het
Itk G T 11: 46,280,153 (GRCm39) R29S probably damaging Het
Ivns1abp G T 1: 151,237,242 (GRCm39) G469C probably damaging Het
Jph3 A T 8: 122,511,598 (GRCm39) N529Y possibly damaging Het
Kdm2b A G 5: 123,019,120 (GRCm39) L829P probably damaging Het
Kprp T A 3: 92,732,033 (GRCm39) Y339F probably damaging Het
Lrp2 A G 2: 69,333,005 (GRCm39) V1504A possibly damaging Het
Lypd6b A G 2: 49,833,615 (GRCm39) D85G probably damaging Het
Mansc4 T C 6: 146,977,136 (GRCm39) Y160C probably damaging Het
Mgll C A 6: 88,790,871 (GRCm39) H164N probably benign Het
Mtmr4 A T 11: 87,504,342 (GRCm39) D1097V probably damaging Het
Nfasc T C 1: 132,536,241 (GRCm39) K571E probably damaging Het
Nfat5 A T 8: 108,097,205 (GRCm39) N1527Y probably damaging Het
Nlgn1 A G 3: 25,966,808 (GRCm39) L215P probably damaging Het
Or6b9 T A 7: 106,555,235 (GRCm39) I303L probably benign Het
Pde4dip T C 3: 97,627,020 (GRCm39) S1173G probably damaging Het
Prrt3 A T 6: 113,472,468 (GRCm39) V568E probably damaging Het
Ptpra G A 2: 130,383,313 (GRCm39) R503Q possibly damaging Het
Pttg1ip2 C A 5: 5,502,019 (GRCm39) W144C probably benign Het
Rnf7l A G 10: 63,257,427 (GRCm39) L31P probably damaging Het
Sema5a G A 15: 32,618,995 (GRCm39) A508T probably benign Het
Serpinb11 T C 1: 107,307,418 (GRCm39) I283T possibly damaging Het
Setbp1 A T 18: 78,901,807 (GRCm39) L620Q probably damaging Het
Sipa1l3 A T 7: 29,082,628 (GRCm39) C756S probably benign Het
Sirpa A T 2: 129,471,961 (GRCm39) I463F probably damaging Het
Slc13a2 G T 11: 78,293,990 (GRCm39) N257K probably damaging Het
Slc4a5 C A 6: 83,248,039 (GRCm39) T530N probably damaging Het
Stab2 A T 10: 86,714,790 (GRCm39) F125L probably benign Het
Tet2 G T 3: 133,175,280 (GRCm39) Q1356K probably benign Het
Tet3 A T 6: 83,363,010 (GRCm39) S856T probably damaging Het
Tg C T 15: 66,565,279 (GRCm39) T1207I possibly damaging Het
Tkt A G 14: 30,287,525 (GRCm39) Y173C probably damaging Het
Tlr6 T A 5: 65,110,754 (GRCm39) I718F probably damaging Het
Tnfrsf11b A G 15: 54,117,454 (GRCm39) V267A possibly damaging Het
Vmn2r118 C T 17: 55,915,083 (GRCm39) C521Y probably damaging Het
Vps16 A G 2: 130,282,260 (GRCm39) D394G probably benign Het
Zfp236 A T 18: 82,692,549 (GRCm39) M142K possibly damaging Het
Zfp780b T C 7: 27,664,282 (GRCm39) D91G probably benign Het
Zfp97 T A 17: 17,365,468 (GRCm39) Y322* probably null Het
Other mutations in Ubqln3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00656:Ubqln3 APN 7 103,790,984 (GRCm39) missense probably benign 0.00
IGL00766:Ubqln3 APN 7 103,792,031 (GRCm39) missense probably benign 0.00
IGL01451:Ubqln3 APN 7 103,791,403 (GRCm39) missense possibly damaging 0.71
IGL01673:Ubqln3 APN 7 103,791,605 (GRCm39) missense probably benign 0.12
IGL01705:Ubqln3 APN 7 103,791,884 (GRCm39) missense probably damaging 1.00
IGL01988:Ubqln3 APN 7 103,792,089 (GRCm39) utr 5 prime probably benign
IGL02008:Ubqln3 APN 7 103,791,523 (GRCm39) missense probably damaging 1.00
IGL02072:Ubqln3 APN 7 103,790,506 (GRCm39) missense possibly damaging 0.69
IGL02546:Ubqln3 APN 7 103,791,725 (GRCm39) missense probably benign 0.02
IGL02657:Ubqln3 APN 7 103,791,170 (GRCm39) missense probably damaging 0.97
IGL02682:Ubqln3 APN 7 103,791,272 (GRCm39) missense probably benign 0.19
IGL02709:Ubqln3 APN 7 103,790,543 (GRCm39) missense probably benign 0.12
IGL03357:Ubqln3 APN 7 103,791,763 (GRCm39) missense probably benign
PIT4544001:Ubqln3 UTSW 7 103,790,550 (GRCm39) missense probably damaging 0.97
R0180:Ubqln3 UTSW 7 103,791,047 (GRCm39) missense probably damaging 1.00
R0845:Ubqln3 UTSW 7 103,791,275 (GRCm39) missense probably damaging 0.98
R1019:Ubqln3 UTSW 7 103,790,593 (GRCm39) missense probably benign 0.00
R1280:Ubqln3 UTSW 7 103,791,283 (GRCm39) missense possibly damaging 0.85
R1448:Ubqln3 UTSW 7 103,791,997 (GRCm39) missense probably damaging 1.00
R1617:Ubqln3 UTSW 7 103,792,067 (GRCm39) missense possibly damaging 0.95
R1650:Ubqln3 UTSW 7 103,790,228 (GRCm39) missense possibly damaging 0.84
R2060:Ubqln3 UTSW 7 103,791,358 (GRCm39) missense probably damaging 1.00
R2246:Ubqln3 UTSW 7 103,791,518 (GRCm39) missense probably damaging 1.00
R2263:Ubqln3 UTSW 7 103,790,842 (GRCm39) nonsense probably null
R2366:Ubqln3 UTSW 7 103,790,256 (GRCm39) missense probably damaging 0.99
R4232:Ubqln3 UTSW 7 103,791,010 (GRCm39) missense probably benign 0.00
R4447:Ubqln3 UTSW 7 103,792,021 (GRCm39) missense probably benign 0.31
R4509:Ubqln3 UTSW 7 103,790,651 (GRCm39) missense probably damaging 0.97
R4604:Ubqln3 UTSW 7 103,791,698 (GRCm39) missense probably benign 0.00
R5416:Ubqln3 UTSW 7 103,790,879 (GRCm39) missense probably benign 0.34
R5617:Ubqln3 UTSW 7 103,791,640 (GRCm39) missense probably damaging 0.99
R5648:Ubqln3 UTSW 7 103,790,117 (GRCm39) missense probably damaging 0.99
R5722:Ubqln3 UTSW 7 103,790,674 (GRCm39) missense probably benign 0.00
R5723:Ubqln3 UTSW 7 103,790,674 (GRCm39) missense probably benign 0.00
R5724:Ubqln3 UTSW 7 103,790,674 (GRCm39) missense probably benign 0.00
R5819:Ubqln3 UTSW 7 103,790,674 (GRCm39) missense probably benign 0.00
R5820:Ubqln3 UTSW 7 103,790,674 (GRCm39) missense probably benign 0.00
R5966:Ubqln3 UTSW 7 103,790,906 (GRCm39) missense probably benign 0.03
R6260:Ubqln3 UTSW 7 103,791,524 (GRCm39) nonsense probably null
R6272:Ubqln3 UTSW 7 103,791,385 (GRCm39) missense probably damaging 1.00
R6542:Ubqln3 UTSW 7 103,790,824 (GRCm39) missense probably benign 0.00
R6936:Ubqln3 UTSW 7 103,791,517 (GRCm39) missense probably damaging 1.00
R7023:Ubqln3 UTSW 7 103,790,630 (GRCm39) missense probably damaging 1.00
R7025:Ubqln3 UTSW 7 103,790,482 (GRCm39) missense probably benign 0.01
R7079:Ubqln3 UTSW 7 103,790,578 (GRCm39) missense probably benign 0.12
R7733:Ubqln3 UTSW 7 103,790,283 (GRCm39) missense probably damaging 0.98
R7764:Ubqln3 UTSW 7 103,790,443 (GRCm39) missense possibly damaging 0.52
R7919:Ubqln3 UTSW 7 103,790,399 (GRCm39) missense probably benign 0.03
R7961:Ubqln3 UTSW 7 103,791,797 (GRCm39) missense probably benign 0.00
R8009:Ubqln3 UTSW 7 103,791,797 (GRCm39) missense probably benign 0.00
R9619:Ubqln3 UTSW 7 103,791,053 (GRCm39) missense probably benign 0.05
R9652:Ubqln3 UTSW 7 103,791,962 (GRCm39) missense probably damaging 1.00
RF054:Ubqln3 UTSW 7 103,790,385 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- TTGCATGACACGGGGATTTGCC -3'
(R):5'- AATTGTGACCCTCTGCCCAACC -3'

Sequencing Primer
(F):5'- CATGGCTGTCTGAAGATGCAAC -3'
(R):5'- GGGTACTGTGCCAACTTCAAATC -3'
Posted On 2014-04-13