Incidental Mutation 'R1550:Fbxw24'
ID169856
Institutional Source Beutler Lab
Gene Symbol Fbxw24
Ensembl Gene ENSMUSG00000062275
Gene NameF-box and WD-40 domain protein 24
SynonymsGm5162
MMRRC Submission 039589-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R1550 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location109601116-109626057 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 109607044 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 307 (R307S)
Ref Sequence ENSEMBL: ENSMUSP00000073617 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073962]
Predicted Effect probably benign
Transcript: ENSMUST00000073962
AA Change: R307S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000073617
Gene: ENSMUSG00000062275
AA Change: R307S

DomainStartEndE-ValueType
FBOX 8 45 3.25e-4 SMART
SCOP:d1gxra_ 87 227 8e-7 SMART
Blast:WD40 137 176 1e-6 BLAST
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.4%
  • 20x: 89.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik C A 5: 5,452,019 W144C probably benign Het
Abcc6 A G 7: 46,005,244 V551A probably benign Het
Acss1 A T 2: 150,642,795 L176Q probably damaging Het
Aldh7a1 A G 18: 56,550,382 I117T possibly damaging Het
Arf5 C T 6: 28,426,153 R180C probably damaging Het
Arhgap21 A T 2: 20,881,765 Y39* probably null Het
Arrdc1 A G 2: 24,926,339 L206P probably damaging Het
Cby3 A T 11: 50,359,486 Y173F probably damaging Het
Cdh18 T A 15: 23,436,548 C497S probably damaging Het
Cyp11b2 T C 15: 74,853,593 I226V probably benign Het
Ddit4l T A 3: 137,624,275 probably null Het
Ddx11 C T 17: 66,138,220 T405I probably benign Het
Dhx40 A T 11: 86,776,739 probably null Het
Dlgap2 A G 8: 14,822,499 D659G probably damaging Het
Eef2 A G 10: 81,180,847 E586G probably benign Het
Fam161a A G 11: 23,020,470 Q216R possibly damaging Het
Gbp2b G T 3: 142,606,830 A325S probably damaging Het
Gli1 A T 10: 127,338,516 F2Y probably damaging Het
Gm7075 A G 10: 63,421,648 L31P probably damaging Het
Gnl2 T C 4: 125,044,234 V269A probably damaging Het
Grin1 A G 2: 25,305,131 V292A probably benign Het
Heg1 T A 16: 33,735,553 V1001E probably damaging Het
Herc2 T A 7: 56,135,658 I1552N probably damaging Het
Htr1a A G 13: 105,445,280 T343A probably benign Het
Itk G T 11: 46,389,326 R29S probably damaging Het
Ivns1abp G T 1: 151,361,491 G469C probably damaging Het
Jph3 A T 8: 121,784,859 N529Y possibly damaging Het
Kdm2b A G 5: 122,881,057 L829P probably damaging Het
Kprp T A 3: 92,824,726 Y339F probably damaging Het
Lrp2 A G 2: 69,502,661 V1504A possibly damaging Het
Lypd6b A G 2: 49,943,603 D85G probably damaging Het
Mansc4 T C 6: 147,075,638 Y160C probably damaging Het
Mgll C A 6: 88,813,889 H164N probably benign Het
Mtmr4 A T 11: 87,613,516 D1097V probably damaging Het
Nfasc T C 1: 132,608,503 K571E probably damaging Het
Nfat5 A T 8: 107,370,573 N1527Y probably damaging Het
Nlgn1 A G 3: 25,912,644 L215P probably damaging Het
Olfr6 T A 7: 106,956,028 I303L probably benign Het
Pde4dip T C 3: 97,719,704 S1173G probably damaging Het
Prrt3 A T 6: 113,495,507 V568E probably damaging Het
Ptpra G A 2: 130,541,393 R503Q possibly damaging Het
Sema5a G A 15: 32,618,849 A508T probably benign Het
Serpinb11 T C 1: 107,379,688 I283T possibly damaging Het
Setbp1 A T 18: 78,858,592 L620Q probably damaging Het
Sipa1l3 A T 7: 29,383,203 C756S probably benign Het
Sirpa A T 2: 129,630,041 I463F probably damaging Het
Slc13a2 G T 11: 78,403,164 N257K probably damaging Het
Slc4a5 C A 6: 83,271,057 T530N probably damaging Het
Stab2 A T 10: 86,878,926 F125L probably benign Het
Tet2 G T 3: 133,469,519 Q1356K probably benign Het
Tet3 A T 6: 83,386,028 S856T probably damaging Het
Tg C T 15: 66,693,430 T1207I possibly damaging Het
Tkt A G 14: 30,565,568 Y173C probably damaging Het
Tlr6 T A 5: 64,953,411 I718F probably damaging Het
Tnfrsf11b A G 15: 54,254,058 V267A possibly damaging Het
Ubqln3 T A 7: 104,141,546 N446Y probably damaging Het
Vmn2r118 C T 17: 55,608,083 C521Y probably damaging Het
Vps16 A G 2: 130,440,340 D394G probably benign Het
Zfp236 A T 18: 82,674,424 M142K possibly damaging Het
Zfp780b T C 7: 27,964,857 D91G probably benign Het
Zfp97 T A 17: 17,145,206 Y322* probably null Het
Other mutations in Fbxw24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01093:Fbxw24 APN 9 109604973 missense probably benign 0.00
IGL01373:Fbxw24 APN 9 109623633 missense probably damaging 0.98
IGL01996:Fbxw24 APN 9 109605372 missense possibly damaging 0.84
IGL02179:Fbxw24 APN 9 109609905 nonsense probably null
IGL02718:Fbxw24 APN 9 109624790 missense possibly damaging 0.55
IGL02936:Fbxw24 APN 9 109624958 splice site probably null
IGL03010:Fbxw24 APN 9 109623610 missense probably benign 0.07
IGL03350:Fbxw24 APN 9 109607013 missense probably damaging 1.00
IGL03402:Fbxw24 APN 9 109601248 missense probably damaging 1.00
R0140:Fbxw24 UTSW 9 109605414 missense possibly damaging 0.73
R0718:Fbxw24 UTSW 9 109623509 splice site probably benign
R1166:Fbxw24 UTSW 9 109606998 missense probably benign 0.00
R1950:Fbxw24 UTSW 9 109605413 missense probably benign 0.02
R1986:Fbxw24 UTSW 9 109607056 missense probably damaging 0.97
R2244:Fbxw24 UTSW 9 109605049 missense possibly damaging 0.66
R3683:Fbxw24 UTSW 9 109608042 missense possibly damaging 0.51
R4324:Fbxw24 UTSW 9 109604945 critical splice donor site probably null
R4387:Fbxw24 UTSW 9 109609985 missense probably damaging 1.00
R4409:Fbxw24 UTSW 9 109608188 missense probably damaging 1.00
R4410:Fbxw24 UTSW 9 109608188 missense probably damaging 1.00
R4803:Fbxw24 UTSW 9 109624842 missense probably benign 0.02
R5571:Fbxw24 UTSW 9 109606998 missense probably benign 0.00
R6042:Fbxw24 UTSW 9 109607011 missense probably benign 0.09
R6523:Fbxw24 UTSW 9 109604980 nonsense probably null
R6799:Fbxw24 UTSW 9 109624930 missense probably damaging 1.00
R7122:Fbxw24 UTSW 9 109601260 missense probably benign 0.03
R7239:Fbxw24 UTSW 9 109605530 missense possibly damaging 0.71
R7405:Fbxw24 UTSW 9 109607068 missense possibly damaging 0.46
R7705:Fbxw24 UTSW 9 109608448 intron probably null
Predicted Primers PCR Primer
(F):5'- GGCCTAAGCCATTTTGCCACAC -3'
(R):5'- TAGAACAGATGGGGCCACTTCTGG -3'

Sequencing Primer
(F):5'- tcttactatgtgtctgtgtctaacc -3'
(R):5'- AAGCCCCTCATGTGGAGTG -3'
Posted On2014-04-13