Incidental Mutation 'R1550:Stab2'
ID 169859
Institutional Source Beutler Lab
Gene Symbol Stab2
Ensembl Gene ENSMUSG00000035459
Gene Name stabilin 2
Synonyms FEEL-2, STAB-2
MMRRC Submission 039589-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1550 (G1)
Quality Score 208
Status Not validated
Chromosome 10
Chromosomal Location 86677062-86843889 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 86714790 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 125 (F125L)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035288]
AlphaFold Q8R4U0
Predicted Effect probably benign
Transcript: ENSMUST00000035288
AA Change: F1576L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000048309
Gene: ENSMUSG00000035459
AA Change: F1576L

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EGF 119 156 1.85e0 SMART
EGF 167 201 2.43e1 SMART
EGF 206 244 1.43e-1 SMART
EGF 248 284 3.82e-2 SMART
EGF 333 370 2.02e-1 SMART
FAS1 414 515 1.06e-8 SMART
FAS1 561 662 3.54e-19 SMART
EGF 746 783 6.76e-3 SMART
EGF 836 873 1.31e0 SMART
EGF 877 917 2.99e-4 SMART
EGF 921 960 3.51e-1 SMART
EGF 964 1002 1.99e0 SMART
FAS1 1038 1138 1.73e-13 SMART
FAS1 1181 1276 1.83e-12 SMART
EGF 1354 1391 6.92e0 SMART
EGF 1401 1435 1.11e1 SMART
EGF 1442 1477 3.01e0 SMART
EGF 1481 1519 1.64e-1 SMART
EGF 1523 1561 1.14e0 SMART
EGF 1565 1603 5.62e0 SMART
FAS1 1638 1734 2.23e-25 SMART
FAS1 1785 1891 6.92e-22 SMART
EGF 1966 2006 1.95e1 SMART
EGF_like 1977 2017 2.46e-1 SMART
EGF 2016 2050 1.14e0 SMART
EGF 2058 2089 1.56e1 SMART
EGF 2093 2130 1.36e1 SMART
EGF 2134 2173 2.13e0 SMART
LINK 2204 2298 2.08e-29 SMART
FAS1 2363 2455 3.19e-12 SMART
transmembrane domain 2467 2489 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159023
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159118
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159445
Predicted Effect probably benign
Transcript: ENSMUST00000161560
AA Change: F125L

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000125263
Gene: ENSMUSG00000035459
AA Change: F125L

DomainStartEndE-ValueType
EGF 30 68 1.64e-1 SMART
EGF 72 110 1.14e0 SMART
EGF 114 152 5.62e0 SMART
FAS1 187 283 2.23e-25 SMART
FAS1 334 440 6.92e-22 SMART
EGF 515 555 1.95e1 SMART
EGF_like 526 566 2.46e-1 SMART
EGF 565 599 1.14e0 SMART
EGF 607 638 1.56e1 SMART
EGF 643 680 1.36e1 SMART
EGF 684 723 2.13e0 SMART
LINK 754 848 2.08e-29 SMART
Predicted Effect unknown
Transcript: ENSMUST00000219341
AA Change: F124L
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219659
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219612
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.4%
  • 20x: 89.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large, transmembrane receptor protein which may function in angiogenesis, lymphocyte homing, cell adhesion, or receptor scavenging. The protein contains 7 fasciclin, 15 epidermal growth factor (EGF)-like, and 2 laminin-type EGF-like domains as well as a C-type lectin-like hyaluronan-binding Link module. The protein is primarily expressed on sinusoidal endothelial cells of liver, spleen, and lymph node. The receptor has been shown to bind and endocytose ligands such as hyaluronan, low density lipoprotein, Gram-positive and Gram-negative bacteria, and advanced glycosylation end products. Supporting its possible role as a scavenger receptor, the protein has been shown to cycle between the plasma membrane and lysosomes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for knock-out alleles exhibit no gross abnormaities. Mice homozygous for one null allele display elevated serum hyaluronic acid levels and decreased metastasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 A G 7: 45,654,668 (GRCm39) V551A probably benign Het
Acss1 A T 2: 150,484,715 (GRCm39) L176Q probably damaging Het
Aldh7a1 A G 18: 56,683,454 (GRCm39) I117T possibly damaging Het
Arf5 C T 6: 28,426,152 (GRCm39) R180C probably damaging Het
Arhgap21 A T 2: 20,886,576 (GRCm39) Y39* probably null Het
Arrdc1 A G 2: 24,816,351 (GRCm39) L206P probably damaging Het
Cby3 A T 11: 50,250,313 (GRCm39) Y173F probably damaging Het
Cdh18 T A 15: 23,436,634 (GRCm39) C497S probably damaging Het
Cyp11b2 T C 15: 74,725,442 (GRCm39) I226V probably benign Het
Ddit4l T A 3: 137,330,036 (GRCm39) probably null Het
Ddx11 C T 17: 66,445,215 (GRCm39) T405I probably benign Het
Dhx40 A T 11: 86,667,565 (GRCm39) probably null Het
Dlgap2 A G 8: 14,872,499 (GRCm39) D659G probably damaging Het
Eef2 A G 10: 81,016,681 (GRCm39) E586G probably benign Het
Fam161a A G 11: 22,970,470 (GRCm39) Q216R possibly damaging Het
Fbxw24 G T 9: 109,436,112 (GRCm39) R307S probably benign Het
Gbp2b G T 3: 142,312,591 (GRCm39) A325S probably damaging Het
Gli1 A T 10: 127,174,385 (GRCm39) F2Y probably damaging Het
Gnl2 T C 4: 124,938,027 (GRCm39) V269A probably damaging Het
Grin1 A G 2: 25,195,143 (GRCm39) V292A probably benign Het
Heg1 T A 16: 33,555,923 (GRCm39) V1001E probably damaging Het
Herc2 T A 7: 55,785,406 (GRCm39) I1552N probably damaging Het
Htr1a A G 13: 105,581,788 (GRCm39) T343A probably benign Het
Itk G T 11: 46,280,153 (GRCm39) R29S probably damaging Het
Ivns1abp G T 1: 151,237,242 (GRCm39) G469C probably damaging Het
Jph3 A T 8: 122,511,598 (GRCm39) N529Y possibly damaging Het
Kdm2b A G 5: 123,019,120 (GRCm39) L829P probably damaging Het
Kprp T A 3: 92,732,033 (GRCm39) Y339F probably damaging Het
Lrp2 A G 2: 69,333,005 (GRCm39) V1504A possibly damaging Het
Lypd6b A G 2: 49,833,615 (GRCm39) D85G probably damaging Het
Mansc4 T C 6: 146,977,136 (GRCm39) Y160C probably damaging Het
Mgll C A 6: 88,790,871 (GRCm39) H164N probably benign Het
Mtmr4 A T 11: 87,504,342 (GRCm39) D1097V probably damaging Het
Nfasc T C 1: 132,536,241 (GRCm39) K571E probably damaging Het
Nfat5 A T 8: 108,097,205 (GRCm39) N1527Y probably damaging Het
Nlgn1 A G 3: 25,966,808 (GRCm39) L215P probably damaging Het
Or6b9 T A 7: 106,555,235 (GRCm39) I303L probably benign Het
Pde4dip T C 3: 97,627,020 (GRCm39) S1173G probably damaging Het
Prrt3 A T 6: 113,472,468 (GRCm39) V568E probably damaging Het
Ptpra G A 2: 130,383,313 (GRCm39) R503Q possibly damaging Het
Pttg1ip2 C A 5: 5,502,019 (GRCm39) W144C probably benign Het
Rnf7l A G 10: 63,257,427 (GRCm39) L31P probably damaging Het
Sema5a G A 15: 32,618,995 (GRCm39) A508T probably benign Het
Serpinb11 T C 1: 107,307,418 (GRCm39) I283T possibly damaging Het
Setbp1 A T 18: 78,901,807 (GRCm39) L620Q probably damaging Het
Sipa1l3 A T 7: 29,082,628 (GRCm39) C756S probably benign Het
Sirpa A T 2: 129,471,961 (GRCm39) I463F probably damaging Het
Slc13a2 G T 11: 78,293,990 (GRCm39) N257K probably damaging Het
Slc4a5 C A 6: 83,248,039 (GRCm39) T530N probably damaging Het
Tet2 G T 3: 133,175,280 (GRCm39) Q1356K probably benign Het
Tet3 A T 6: 83,363,010 (GRCm39) S856T probably damaging Het
Tg C T 15: 66,565,279 (GRCm39) T1207I possibly damaging Het
Tkt A G 14: 30,287,525 (GRCm39) Y173C probably damaging Het
Tlr6 T A 5: 65,110,754 (GRCm39) I718F probably damaging Het
Tnfrsf11b A G 15: 54,117,454 (GRCm39) V267A possibly damaging Het
Ubqln3 T A 7: 103,790,753 (GRCm39) N446Y probably damaging Het
Vmn2r118 C T 17: 55,915,083 (GRCm39) C521Y probably damaging Het
Vps16 A G 2: 130,282,260 (GRCm39) D394G probably benign Het
Zfp236 A T 18: 82,692,549 (GRCm39) M142K possibly damaging Het
Zfp780b T C 7: 27,664,282 (GRCm39) D91G probably benign Het
Zfp97 T A 17: 17,365,468 (GRCm39) Y322* probably null Het
Other mutations in Stab2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Stab2 APN 10 86,705,070 (GRCm39) splice site probably null
IGL00809:Stab2 APN 10 86,684,038 (GRCm39) splice site probably benign
IGL00911:Stab2 APN 10 86,805,617 (GRCm39) missense probably damaging 1.00
IGL01347:Stab2 APN 10 86,737,567 (GRCm39) splice site probably null
IGL01411:Stab2 APN 10 86,815,872 (GRCm39) splice site probably benign
IGL01503:Stab2 APN 10 86,776,477 (GRCm39) splice site probably benign
IGL01599:Stab2 APN 10 86,758,759 (GRCm39) missense probably damaging 1.00
IGL01635:Stab2 APN 10 86,816,992 (GRCm39) missense probably benign 0.04
IGL01640:Stab2 APN 10 86,790,035 (GRCm39) missense probably benign 0.09
IGL01671:Stab2 APN 10 86,805,141 (GRCm39) missense possibly damaging 0.80
IGL02023:Stab2 APN 10 86,707,695 (GRCm39) missense possibly damaging 0.67
IGL02075:Stab2 APN 10 86,803,514 (GRCm39) missense possibly damaging 0.71
IGL02174:Stab2 APN 10 86,695,606 (GRCm39) splice site probably null
IGL02600:Stab2 APN 10 86,790,123 (GRCm39) missense probably damaging 1.00
IGL02666:Stab2 APN 10 86,686,766 (GRCm39) missense possibly damaging 0.67
IGL02668:Stab2 APN 10 86,682,027 (GRCm39) splice site probably benign
IGL02709:Stab2 APN 10 86,682,029 (GRCm39) splice site probably benign
IGL02728:Stab2 APN 10 86,692,420 (GRCm39) missense possibly damaging 0.95
IGL02803:Stab2 APN 10 86,786,133 (GRCm39) splice site probably benign
IGL02938:Stab2 APN 10 86,707,785 (GRCm39) missense possibly damaging 0.77
IGL03033:Stab2 APN 10 86,832,667 (GRCm39) critical splice donor site probably null
IGL03238:Stab2 APN 10 86,690,985 (GRCm39) missense probably damaging 1.00
IGL03402:Stab2 APN 10 86,805,165 (GRCm39) missense probably benign 0.03
prospector UTSW 10 86,737,431 (GRCm39) splice site probably null
songbird UTSW 10 86,694,016 (GRCm39) missense probably damaging 1.00
3-1:Stab2 UTSW 10 86,705,041 (GRCm39) missense probably damaging 0.96
F6893:Stab2 UTSW 10 86,691,035 (GRCm39) missense probably damaging 1.00
K7371:Stab2 UTSW 10 86,779,153 (GRCm39) critical splice donor site probably null
PIT4142001:Stab2 UTSW 10 86,703,039 (GRCm39) missense possibly damaging 0.94
PIT4362001:Stab2 UTSW 10 86,697,299 (GRCm39) nonsense probably null
R0015:Stab2 UTSW 10 86,679,481 (GRCm39) missense probably benign
R0254:Stab2 UTSW 10 86,733,824 (GRCm39) missense probably benign
R0310:Stab2 UTSW 10 86,803,477 (GRCm39) splice site probably benign
R0333:Stab2 UTSW 10 86,677,491 (GRCm39) missense probably benign
R0391:Stab2 UTSW 10 86,783,008 (GRCm39) missense probably benign 0.27
R0400:Stab2 UTSW 10 86,708,474 (GRCm39) missense probably damaging 1.00
R0433:Stab2 UTSW 10 86,679,355 (GRCm39) splice site probably benign
R0440:Stab2 UTSW 10 86,785,792 (GRCm39) missense probably benign 0.23
R0743:Stab2 UTSW 10 86,723,759 (GRCm39) missense probably damaging 1.00
R0847:Stab2 UTSW 10 86,805,735 (GRCm39) missense probably benign 0.00
R0883:Stab2 UTSW 10 86,760,314 (GRCm39) splice site probably benign
R1078:Stab2 UTSW 10 86,742,997 (GRCm39) splice site probably null
R1118:Stab2 UTSW 10 86,721,582 (GRCm39) splice site probably null
R1119:Stab2 UTSW 10 86,695,619 (GRCm39) missense possibly damaging 0.51
R1179:Stab2 UTSW 10 86,786,165 (GRCm39) missense probably damaging 0.98
R1440:Stab2 UTSW 10 86,697,231 (GRCm39) splice site probably null
R1616:Stab2 UTSW 10 86,721,582 (GRCm39) splice site probably null
R1728:Stab2 UTSW 10 86,773,903 (GRCm39) missense probably benign 0.41
R1768:Stab2 UTSW 10 86,838,872 (GRCm39) missense probably damaging 1.00
R1772:Stab2 UTSW 10 86,790,098 (GRCm39) missense probably benign 0.06
R1776:Stab2 UTSW 10 86,793,680 (GRCm39) missense possibly damaging 0.92
R1784:Stab2 UTSW 10 86,773,903 (GRCm39) missense probably benign 0.41
R1892:Stab2 UTSW 10 86,773,913 (GRCm39) missense probably damaging 0.99
R1957:Stab2 UTSW 10 86,697,334 (GRCm39) missense probably benign 0.13
R1972:Stab2 UTSW 10 86,796,180 (GRCm39) missense probably damaging 0.99
R1975:Stab2 UTSW 10 86,732,360 (GRCm39) critical splice donor site probably null
R1976:Stab2 UTSW 10 86,732,360 (GRCm39) critical splice donor site probably null
R1996:Stab2 UTSW 10 86,838,895 (GRCm39) missense probably damaging 1.00
R2085:Stab2 UTSW 10 86,790,023 (GRCm39) missense probably damaging 1.00
R2149:Stab2 UTSW 10 86,700,904 (GRCm39) nonsense probably null
R2169:Stab2 UTSW 10 86,723,726 (GRCm39) missense probably damaging 1.00
R2201:Stab2 UTSW 10 86,776,503 (GRCm39) missense probably benign 0.22
R2296:Stab2 UTSW 10 86,790,338 (GRCm39) critical splice acceptor site probably null
R2297:Stab2 UTSW 10 86,790,338 (GRCm39) critical splice acceptor site probably null
R2298:Stab2 UTSW 10 86,790,338 (GRCm39) critical splice acceptor site probably null
R2326:Stab2 UTSW 10 86,790,338 (GRCm39) critical splice acceptor site probably null
R2434:Stab2 UTSW 10 86,805,183 (GRCm39) missense possibly damaging 0.78
R2519:Stab2 UTSW 10 86,770,704 (GRCm39) splice site probably benign
R2696:Stab2 UTSW 10 86,697,363 (GRCm39) missense probably benign 0.45
R2883:Stab2 UTSW 10 86,803,550 (GRCm39) missense possibly damaging 0.92
R2923:Stab2 UTSW 10 86,697,325 (GRCm39) missense probably damaging 1.00
R3711:Stab2 UTSW 10 86,702,572 (GRCm39) missense probably damaging 1.00
R3787:Stab2 UTSW 10 86,805,141 (GRCm39) missense possibly damaging 0.50
R3834:Stab2 UTSW 10 86,785,776 (GRCm39) missense possibly damaging 0.87
R3970:Stab2 UTSW 10 86,714,750 (GRCm39) missense probably damaging 0.97
R3979:Stab2 UTSW 10 86,699,320 (GRCm39) missense possibly damaging 0.56
R4003:Stab2 UTSW 10 86,693,988 (GRCm39) missense probably damaging 1.00
R4088:Stab2 UTSW 10 86,758,049 (GRCm39) missense probably damaging 1.00
R4151:Stab2 UTSW 10 86,838,847 (GRCm39) missense probably benign 0.12
R4190:Stab2 UTSW 10 86,714,808 (GRCm39) missense probably damaging 0.98
R4556:Stab2 UTSW 10 86,803,543 (GRCm39) missense possibly damaging 0.95
R4773:Stab2 UTSW 10 86,743,235 (GRCm39) nonsense probably null
R4825:Stab2 UTSW 10 86,783,011 (GRCm39) missense probably benign 0.08
R4865:Stab2 UTSW 10 86,679,364 (GRCm39) splice site probably null
R4871:Stab2 UTSW 10 86,778,099 (GRCm39) missense probably damaging 0.99
R4943:Stab2 UTSW 10 86,790,026 (GRCm39) missense probably damaging 0.99
R4981:Stab2 UTSW 10 86,796,087 (GRCm39) missense probably benign
R4994:Stab2 UTSW 10 86,785,771 (GRCm39) missense probably benign
R4999:Stab2 UTSW 10 86,773,773 (GRCm39) missense probably damaging 0.97
R5061:Stab2 UTSW 10 86,743,249 (GRCm39) missense probably damaging 1.00
R5072:Stab2 UTSW 10 86,699,422 (GRCm39) missense probably benign 0.23
R5073:Stab2 UTSW 10 86,699,422 (GRCm39) missense probably benign 0.23
R5074:Stab2 UTSW 10 86,699,422 (GRCm39) missense probably benign 0.23
R5134:Stab2 UTSW 10 86,707,674 (GRCm39) splice site probably null
R5213:Stab2 UTSW 10 86,743,061 (GRCm39) missense probably damaging 0.99
R5508:Stab2 UTSW 10 86,796,143 (GRCm39) missense probably benign 0.01
R5530:Stab2 UTSW 10 86,783,026 (GRCm39) missense probably benign 0.04
R5540:Stab2 UTSW 10 86,683,989 (GRCm39) missense probably benign 0.30
R5839:Stab2 UTSW 10 86,708,555 (GRCm39) missense probably damaging 0.97
R5949:Stab2 UTSW 10 86,805,713 (GRCm39) missense possibly damaging 0.87
R6015:Stab2 UTSW 10 86,773,906 (GRCm39) missense probably damaging 0.99
R6019:Stab2 UTSW 10 86,838,886 (GRCm39) missense probably benign 0.00
R6116:Stab2 UTSW 10 86,743,054 (GRCm39) missense probably damaging 1.00
R6131:Stab2 UTSW 10 86,719,642 (GRCm39) splice site probably null
R6209:Stab2 UTSW 10 86,758,867 (GRCm39) missense possibly damaging 0.94
R6243:Stab2 UTSW 10 86,743,025 (GRCm39) missense probably damaging 1.00
R6433:Stab2 UTSW 10 86,737,431 (GRCm39) splice site probably null
R6787:Stab2 UTSW 10 86,754,948 (GRCm39) missense probably benign 0.07
R6841:Stab2 UTSW 10 86,778,054 (GRCm39) missense probably damaging 1.00
R6873:Stab2 UTSW 10 86,697,230 (GRCm39) critical splice donor site probably null
R7025:Stab2 UTSW 10 86,686,701 (GRCm39) missense probably damaging 1.00
R7043:Stab2 UTSW 10 86,706,110 (GRCm39) missense probably damaging 0.99
R7047:Stab2 UTSW 10 86,694,016 (GRCm39) missense probably damaging 1.00
R7107:Stab2 UTSW 10 86,741,456 (GRCm39) missense possibly damaging 0.96
R7214:Stab2 UTSW 10 86,735,705 (GRCm39) missense probably damaging 0.99
R7271:Stab2 UTSW 10 86,838,972 (GRCm39) splice site probably null
R7291:Stab2 UTSW 10 86,782,084 (GRCm39) missense probably damaging 0.96
R7336:Stab2 UTSW 10 86,805,049 (GRCm39) nonsense probably null
R7432:Stab2 UTSW 10 86,721,547 (GRCm39) missense probably damaging 0.99
R7580:Stab2 UTSW 10 86,705,028 (GRCm39) missense probably benign 0.00
R7622:Stab2 UTSW 10 86,709,766 (GRCm39) missense possibly damaging 0.65
R7629:Stab2 UTSW 10 86,719,646 (GRCm39) critical splice donor site probably null
R7658:Stab2 UTSW 10 86,816,999 (GRCm39) missense probably benign 0.12
R7798:Stab2 UTSW 10 86,793,776 (GRCm39) missense probably damaging 0.98
R7835:Stab2 UTSW 10 86,708,483 (GRCm39) missense probably benign 0.06
R7845:Stab2 UTSW 10 86,832,758 (GRCm39) missense probably benign 0.09
R7863:Stab2 UTSW 10 86,808,745 (GRCm39) missense probably benign 0.30
R7885:Stab2 UTSW 10 86,714,776 (GRCm39) missense probably benign 0.03
R7904:Stab2 UTSW 10 86,790,056 (GRCm39) nonsense probably null
R7947:Stab2 UTSW 10 86,681,897 (GRCm39) missense probably benign 0.31
R7963:Stab2 UTSW 10 86,683,887 (GRCm39) critical splice donor site probably null
R8014:Stab2 UTSW 10 86,686,767 (GRCm39) missense possibly damaging 0.78
R8021:Stab2 UTSW 10 86,741,403 (GRCm39) missense possibly damaging 0.69
R8024:Stab2 UTSW 10 86,681,916 (GRCm39) missense probably benign 0.34
R8097:Stab2 UTSW 10 86,704,959 (GRCm39) missense possibly damaging 0.86
R8281:Stab2 UTSW 10 86,709,728 (GRCm39) missense probably damaging 0.98
R8462:Stab2 UTSW 10 86,803,598 (GRCm39) missense possibly damaging 0.79
R8670:Stab2 UTSW 10 86,776,587 (GRCm39) missense probably damaging 1.00
R8692:Stab2 UTSW 10 86,808,794 (GRCm39) missense probably damaging 0.99
R8744:Stab2 UTSW 10 86,805,213 (GRCm39) missense probably benign 0.32
R8745:Stab2 UTSW 10 86,805,213 (GRCm39) missense probably benign 0.32
R8782:Stab2 UTSW 10 86,735,685 (GRCm39) missense probably benign 0.00
R8875:Stab2 UTSW 10 86,832,728 (GRCm39) missense probably damaging 1.00
R8978:Stab2 UTSW 10 86,785,782 (GRCm39) missense possibly damaging 0.64
R9141:Stab2 UTSW 10 86,704,911 (GRCm39) missense probably damaging 1.00
R9248:Stab2 UTSW 10 86,727,481 (GRCm39) missense probably damaging 0.98
R9326:Stab2 UTSW 10 86,791,010 (GRCm39) missense probably damaging 1.00
R9426:Stab2 UTSW 10 86,704,911 (GRCm39) missense probably damaging 1.00
R9568:Stab2 UTSW 10 86,699,420 (GRCm39) missense probably damaging 1.00
R9627:Stab2 UTSW 10 86,793,704 (GRCm39) missense probably damaging 0.98
R9635:Stab2 UTSW 10 86,686,651 (GRCm39) nonsense probably null
R9648:Stab2 UTSW 10 86,692,561 (GRCm39) frame shift probably null
R9649:Stab2 UTSW 10 86,692,561 (GRCm39) frame shift probably null
R9650:Stab2 UTSW 10 86,692,561 (GRCm39) frame shift probably null
R9726:Stab2 UTSW 10 86,790,095 (GRCm39) missense probably benign 0.00
R9756:Stab2 UTSW 10 86,803,553 (GRCm39) missense possibly damaging 0.50
R9786:Stab2 UTSW 10 86,757,997 (GRCm39) missense probably benign 0.03
RF061:Stab2 UTSW 10 86,702,622 (GRCm39) critical splice acceptor site probably benign
X0023:Stab2 UTSW 10 86,758,062 (GRCm39) critical splice acceptor site probably null
X0025:Stab2 UTSW 10 86,723,680 (GRCm39) missense probably damaging 1.00
Z1176:Stab2 UTSW 10 86,785,778 (GRCm39) missense probably damaging 0.99
Z1177:Stab2 UTSW 10 86,732,460 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGCAGAGTTCAATTTCAAACGCAG -3'
(R):5'- TAATGACCCACAACCAAGGGGCTG -3'

Sequencing Primer
(F):5'- tcaatttcaaacgcagatgtttc -3'
(R):5'- tgtgtgtgtgtgttactaggg -3'
Posted On 2014-04-13