Incidental Mutation 'R1550:Slc13a2'
ID 169865
Institutional Source Beutler Lab
Gene Symbol Slc13a2
Ensembl Gene ENSMUSG00000001095
Gene Name solute carrier family 13 (sodium-dependent dicarboxylate transporter), member 2
Synonyms sodium/dicarboxylate co-transporter, mNaDC-1, Nadc1
MMRRC Submission 039589-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1550 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 78288102-78313107 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 78293990 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 257 (N257K)
Ref Sequence ENSEMBL: ENSMUSP00000001122 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001122]
AlphaFold Q9ES88
Predicted Effect probably damaging
Transcript: ENSMUST00000001122
AA Change: N257K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000001122
Gene: ENSMUSG00000001095
AA Change: N257K

DomainStartEndE-ValueType
Pfam:Na_sulph_symp 6 560 7.1e-161 PFAM
Pfam:CitMHS 45 164 3e-15 PFAM
Pfam:CitMHS 203 499 1.5e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149865
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.4%
  • 20x: 89.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a sodium-coupled citrate transporter that is regulated by the chaperone activity of cyclophilin b. The encoded protein may play a role in the formation of kidney stones. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased Kreb cycle intermediates in the urine but otherwise have normal kidney function and response to ischemia-reperfusion injury and caloric restriction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 A G 7: 45,654,668 (GRCm39) V551A probably benign Het
Acss1 A T 2: 150,484,715 (GRCm39) L176Q probably damaging Het
Aldh7a1 A G 18: 56,683,454 (GRCm39) I117T possibly damaging Het
Arf5 C T 6: 28,426,152 (GRCm39) R180C probably damaging Het
Arhgap21 A T 2: 20,886,576 (GRCm39) Y39* probably null Het
Arrdc1 A G 2: 24,816,351 (GRCm39) L206P probably damaging Het
Cby3 A T 11: 50,250,313 (GRCm39) Y173F probably damaging Het
Cdh18 T A 15: 23,436,634 (GRCm39) C497S probably damaging Het
Cyp11b2 T C 15: 74,725,442 (GRCm39) I226V probably benign Het
Ddit4l T A 3: 137,330,036 (GRCm39) probably null Het
Ddx11 C T 17: 66,445,215 (GRCm39) T405I probably benign Het
Dhx40 A T 11: 86,667,565 (GRCm39) probably null Het
Dlgap2 A G 8: 14,872,499 (GRCm39) D659G probably damaging Het
Eef2 A G 10: 81,016,681 (GRCm39) E586G probably benign Het
Fam161a A G 11: 22,970,470 (GRCm39) Q216R possibly damaging Het
Fbxw24 G T 9: 109,436,112 (GRCm39) R307S probably benign Het
Gbp2b G T 3: 142,312,591 (GRCm39) A325S probably damaging Het
Gli1 A T 10: 127,174,385 (GRCm39) F2Y probably damaging Het
Gnl2 T C 4: 124,938,027 (GRCm39) V269A probably damaging Het
Grin1 A G 2: 25,195,143 (GRCm39) V292A probably benign Het
Heg1 T A 16: 33,555,923 (GRCm39) V1001E probably damaging Het
Herc2 T A 7: 55,785,406 (GRCm39) I1552N probably damaging Het
Htr1a A G 13: 105,581,788 (GRCm39) T343A probably benign Het
Itk G T 11: 46,280,153 (GRCm39) R29S probably damaging Het
Ivns1abp G T 1: 151,237,242 (GRCm39) G469C probably damaging Het
Jph3 A T 8: 122,511,598 (GRCm39) N529Y possibly damaging Het
Kdm2b A G 5: 123,019,120 (GRCm39) L829P probably damaging Het
Kprp T A 3: 92,732,033 (GRCm39) Y339F probably damaging Het
Lrp2 A G 2: 69,333,005 (GRCm39) V1504A possibly damaging Het
Lypd6b A G 2: 49,833,615 (GRCm39) D85G probably damaging Het
Mansc4 T C 6: 146,977,136 (GRCm39) Y160C probably damaging Het
Mgll C A 6: 88,790,871 (GRCm39) H164N probably benign Het
Mtmr4 A T 11: 87,504,342 (GRCm39) D1097V probably damaging Het
Nfasc T C 1: 132,536,241 (GRCm39) K571E probably damaging Het
Nfat5 A T 8: 108,097,205 (GRCm39) N1527Y probably damaging Het
Nlgn1 A G 3: 25,966,808 (GRCm39) L215P probably damaging Het
Or6b9 T A 7: 106,555,235 (GRCm39) I303L probably benign Het
Pde4dip T C 3: 97,627,020 (GRCm39) S1173G probably damaging Het
Prrt3 A T 6: 113,472,468 (GRCm39) V568E probably damaging Het
Ptpra G A 2: 130,383,313 (GRCm39) R503Q possibly damaging Het
Pttg1ip2 C A 5: 5,502,019 (GRCm39) W144C probably benign Het
Rnf7l A G 10: 63,257,427 (GRCm39) L31P probably damaging Het
Sema5a G A 15: 32,618,995 (GRCm39) A508T probably benign Het
Serpinb11 T C 1: 107,307,418 (GRCm39) I283T possibly damaging Het
Setbp1 A T 18: 78,901,807 (GRCm39) L620Q probably damaging Het
Sipa1l3 A T 7: 29,082,628 (GRCm39) C756S probably benign Het
Sirpa A T 2: 129,471,961 (GRCm39) I463F probably damaging Het
Slc4a5 C A 6: 83,248,039 (GRCm39) T530N probably damaging Het
Stab2 A T 10: 86,714,790 (GRCm39) F125L probably benign Het
Tet2 G T 3: 133,175,280 (GRCm39) Q1356K probably benign Het
Tet3 A T 6: 83,363,010 (GRCm39) S856T probably damaging Het
Tg C T 15: 66,565,279 (GRCm39) T1207I possibly damaging Het
Tkt A G 14: 30,287,525 (GRCm39) Y173C probably damaging Het
Tlr6 T A 5: 65,110,754 (GRCm39) I718F probably damaging Het
Tnfrsf11b A G 15: 54,117,454 (GRCm39) V267A possibly damaging Het
Ubqln3 T A 7: 103,790,753 (GRCm39) N446Y probably damaging Het
Vmn2r118 C T 17: 55,915,083 (GRCm39) C521Y probably damaging Het
Vps16 A G 2: 130,282,260 (GRCm39) D394G probably benign Het
Zfp236 A T 18: 82,692,549 (GRCm39) M142K possibly damaging Het
Zfp780b T C 7: 27,664,282 (GRCm39) D91G probably benign Het
Zfp97 T A 17: 17,365,468 (GRCm39) Y322* probably null Het
Other mutations in Slc13a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Slc13a2 APN 11 78,291,374 (GRCm39) missense probably damaging 1.00
IGL01604:Slc13a2 APN 11 78,294,221 (GRCm39) missense possibly damaging 0.82
IGL01679:Slc13a2 APN 11 78,295,537 (GRCm39) missense probably damaging 1.00
IGL03100:Slc13a2 APN 11 78,295,299 (GRCm39) missense probably damaging 1.00
IGL03380:Slc13a2 APN 11 78,289,908 (GRCm39) missense probably benign 0.03
deliberate UTSW 11 78,294,306 (GRCm39) critical splice acceptor site probably benign
Familiaris UTSW 11 78,295,621 (GRCm39) missense probably damaging 1.00
intentional UTSW 11 78,295,534 (GRCm39) missense probably damaging 1.00
R0085:Slc13a2 UTSW 11 78,297,694 (GRCm39) missense probably damaging 0.96
R0324:Slc13a2 UTSW 11 78,295,350 (GRCm39) missense probably damaging 1.00
R0368:Slc13a2 UTSW 11 78,295,626 (GRCm39) nonsense probably null
R0440:Slc13a2 UTSW 11 78,294,001 (GRCm39) missense probably benign 0.05
R0539:Slc13a2 UTSW 11 78,289,964 (GRCm39) missense probably damaging 1.00
R1519:Slc13a2 UTSW 11 78,288,572 (GRCm39) missense possibly damaging 0.59
R1909:Slc13a2 UTSW 11 78,290,968 (GRCm39) missense possibly damaging 0.90
R2166:Slc13a2 UTSW 11 78,293,901 (GRCm39) missense probably benign 0.16
R2994:Slc13a2 UTSW 11 78,295,563 (GRCm39) missense probably damaging 1.00
R2998:Slc13a2 UTSW 11 78,295,611 (GRCm39) missense probably damaging 0.99
R3418:Slc13a2 UTSW 11 78,291,666 (GRCm39) missense probably benign 0.05
R3932:Slc13a2 UTSW 11 78,289,226 (GRCm39) missense probably damaging 1.00
R4233:Slc13a2 UTSW 11 78,294,361 (GRCm39) intron probably benign
R4462:Slc13a2 UTSW 11 78,295,213 (GRCm39) missense probably benign 0.44
R5014:Slc13a2 UTSW 11 78,290,987 (GRCm39) missense possibly damaging 0.73
R5170:Slc13a2 UTSW 11 78,291,634 (GRCm39) missense probably damaging 1.00
R5484:Slc13a2 UTSW 11 78,295,648 (GRCm39) splice site probably benign
R5809:Slc13a2 UTSW 11 78,288,647 (GRCm39) missense probably damaging 1.00
R5973:Slc13a2 UTSW 11 78,291,358 (GRCm39) missense probably damaging 0.99
R6243:Slc13a2 UTSW 11 78,295,534 (GRCm39) missense probably damaging 1.00
R6263:Slc13a2 UTSW 11 78,294,306 (GRCm39) critical splice acceptor site probably benign
R6275:Slc13a2 UTSW 11 78,294,306 (GRCm39) critical splice acceptor site probably benign
R6276:Slc13a2 UTSW 11 78,294,306 (GRCm39) critical splice acceptor site probably benign
R6279:Slc13a2 UTSW 11 78,294,306 (GRCm39) critical splice acceptor site probably benign
R6280:Slc13a2 UTSW 11 78,294,306 (GRCm39) critical splice acceptor site probably benign
R6300:Slc13a2 UTSW 11 78,294,306 (GRCm39) critical splice acceptor site probably benign
R6305:Slc13a2 UTSW 11 78,294,306 (GRCm39) critical splice acceptor site probably benign
R6314:Slc13a2 UTSW 11 78,294,306 (GRCm39) critical splice acceptor site probably benign
R6673:Slc13a2 UTSW 11 78,288,657 (GRCm39) missense probably benign 0.12
R7138:Slc13a2 UTSW 11 78,289,950 (GRCm39) missense possibly damaging 0.76
R7382:Slc13a2 UTSW 11 78,295,621 (GRCm39) missense probably damaging 1.00
R7657:Slc13a2 UTSW 11 78,289,223 (GRCm39) missense probably damaging 0.99
R7791:Slc13a2 UTSW 11 78,312,890 (GRCm39) critical splice donor site probably null
R8027:Slc13a2 UTSW 11 78,295,582 (GRCm39) missense probably benign 0.00
R9091:Slc13a2 UTSW 11 78,295,258 (GRCm39) missense probably damaging 1.00
R9270:Slc13a2 UTSW 11 78,295,258 (GRCm39) missense probably damaging 1.00
R9484:Slc13a2 UTSW 11 78,294,233 (GRCm39) missense probably damaging 0.97
R9501:Slc13a2 UTSW 11 78,291,633 (GRCm39) missense probably damaging 1.00
R9783:Slc13a2 UTSW 11 78,294,177 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAACAGGGGCAGCATTCTGCAC -3'
(R):5'- GCATCTGCTACTCAGCCAGCATTG -3'

Sequencing Primer
(F):5'- ACTTGCAGCATGGTCCC -3'
(R):5'- ATTGGGGGCATTGCCAC -3'
Posted On 2014-04-13