Incidental Mutation 'R1550:Dhx40'
ID169866
Institutional Source Beutler Lab
Gene Symbol Dhx40
Ensembl Gene ENSMUSG00000018425
Gene NameDEAH (Asp-Glu-Ala-His) box polypeptide 40
SynonymsARG147, 2410016C14Rik, DDX40
MMRRC Submission 039589-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1550 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location86768846-86807746 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 86776739 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000114918 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018569] [ENSMUST00000148263]
Predicted Effect probably null
Transcript: ENSMUST00000018569
SMART Domains Protein: ENSMUSP00000018569
Gene: ENSMUSG00000018425

DomainStartEndE-ValueType
DEXDc 47 240 6.32e-33 SMART
HELICc 283 401 3.08e-13 SMART
HA2 462 557 1.92e-21 SMART
Pfam:OB_NTP_bind 588 699 1.7e-20 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000148263
SMART Domains Protein: ENSMUSP00000114918
Gene: ENSMUSG00000018425

DomainStartEndE-ValueType
Blast:DEXDc 1 96 3e-60 BLAST
SCOP:d1a1va1 4 59 5e-7 SMART
HA2 164 259 1.92e-21 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.4%
  • 20x: 89.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DExH/D box family of ATP-dependent RNA helicases that have an essential role in RNA metabolism. Alternate splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome 17.[provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik C A 5: 5,452,019 W144C probably benign Het
Abcc6 A G 7: 46,005,244 V551A probably benign Het
Acss1 A T 2: 150,642,795 L176Q probably damaging Het
Aldh7a1 A G 18: 56,550,382 I117T possibly damaging Het
Arf5 C T 6: 28,426,153 R180C probably damaging Het
Arhgap21 A T 2: 20,881,765 Y39* probably null Het
Arrdc1 A G 2: 24,926,339 L206P probably damaging Het
Cby3 A T 11: 50,359,486 Y173F probably damaging Het
Cdh18 T A 15: 23,436,548 C497S probably damaging Het
Cyp11b2 T C 15: 74,853,593 I226V probably benign Het
Ddit4l T A 3: 137,624,275 probably null Het
Ddx11 C T 17: 66,138,220 T405I probably benign Het
Dlgap2 A G 8: 14,822,499 D659G probably damaging Het
Eef2 A G 10: 81,180,847 E586G probably benign Het
Fam161a A G 11: 23,020,470 Q216R possibly damaging Het
Fbxw24 G T 9: 109,607,044 R307S probably benign Het
Gbp2b G T 3: 142,606,830 A325S probably damaging Het
Gli1 A T 10: 127,338,516 F2Y probably damaging Het
Gm7075 A G 10: 63,421,648 L31P probably damaging Het
Gnl2 T C 4: 125,044,234 V269A probably damaging Het
Grin1 A G 2: 25,305,131 V292A probably benign Het
Heg1 T A 16: 33,735,553 V1001E probably damaging Het
Herc2 T A 7: 56,135,658 I1552N probably damaging Het
Htr1a A G 13: 105,445,280 T343A probably benign Het
Itk G T 11: 46,389,326 R29S probably damaging Het
Ivns1abp G T 1: 151,361,491 G469C probably damaging Het
Jph3 A T 8: 121,784,859 N529Y possibly damaging Het
Kdm2b A G 5: 122,881,057 L829P probably damaging Het
Kprp T A 3: 92,824,726 Y339F probably damaging Het
Lrp2 A G 2: 69,502,661 V1504A possibly damaging Het
Lypd6b A G 2: 49,943,603 D85G probably damaging Het
Mansc4 T C 6: 147,075,638 Y160C probably damaging Het
Mgll C A 6: 88,813,889 H164N probably benign Het
Mtmr4 A T 11: 87,613,516 D1097V probably damaging Het
Nfasc T C 1: 132,608,503 K571E probably damaging Het
Nfat5 A T 8: 107,370,573 N1527Y probably damaging Het
Nlgn1 A G 3: 25,912,644 L215P probably damaging Het
Olfr6 T A 7: 106,956,028 I303L probably benign Het
Pde4dip T C 3: 97,719,704 S1173G probably damaging Het
Prrt3 A T 6: 113,495,507 V568E probably damaging Het
Ptpra G A 2: 130,541,393 R503Q possibly damaging Het
Sema5a G A 15: 32,618,849 A508T probably benign Het
Serpinb11 T C 1: 107,379,688 I283T possibly damaging Het
Setbp1 A T 18: 78,858,592 L620Q probably damaging Het
Sipa1l3 A T 7: 29,383,203 C756S probably benign Het
Sirpa A T 2: 129,630,041 I463F probably damaging Het
Slc13a2 G T 11: 78,403,164 N257K probably damaging Het
Slc4a5 C A 6: 83,271,057 T530N probably damaging Het
Stab2 A T 10: 86,878,926 F125L probably benign Het
Tet2 G T 3: 133,469,519 Q1356K probably benign Het
Tet3 A T 6: 83,386,028 S856T probably damaging Het
Tg C T 15: 66,693,430 T1207I possibly damaging Het
Tkt A G 14: 30,565,568 Y173C probably damaging Het
Tlr6 T A 5: 64,953,411 I718F probably damaging Het
Tnfrsf11b A G 15: 54,254,058 V267A possibly damaging Het
Ubqln3 T A 7: 104,141,546 N446Y probably damaging Het
Vmn2r118 C T 17: 55,608,083 C521Y probably damaging Het
Vps16 A G 2: 130,440,340 D394G probably benign Het
Zfp236 A T 18: 82,674,424 M142K possibly damaging Het
Zfp780b T C 7: 27,964,857 D91G probably benign Het
Zfp97 T A 17: 17,145,206 Y322* probably null Het
Other mutations in Dhx40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02366:Dhx40 APN 11 86776702 missense probably damaging 0.98
IGL02818:Dhx40 APN 11 86799505 missense probably benign 0.26
IGL02932:Dhx40 APN 11 86771929 missense probably damaging 1.00
R0312:Dhx40 UTSW 11 86771949 missense probably damaging 0.99
R0485:Dhx40 UTSW 11 86771262 unclassified probably benign
R0542:Dhx40 UTSW 11 86804256 critical splice donor site probably null
R0565:Dhx40 UTSW 11 86771167 missense probably damaging 0.97
R1218:Dhx40 UTSW 11 86799484 missense probably benign 0.13
R1406:Dhx40 UTSW 11 86797745 missense probably benign 0.01
R1406:Dhx40 UTSW 11 86797745 missense probably benign 0.01
R1544:Dhx40 UTSW 11 86806553 missense possibly damaging 0.93
R1839:Dhx40 UTSW 11 86789297 missense possibly damaging 0.46
R2923:Dhx40 UTSW 11 86789263 missense probably benign 0.26
R3743:Dhx40 UTSW 11 86771159 missense probably damaging 0.99
R3864:Dhx40 UTSW 11 86789245 missense possibly damaging 0.85
R4902:Dhx40 UTSW 11 86771210 missense possibly damaging 0.95
R4918:Dhx40 UTSW 11 86804391 missense possibly damaging 0.85
R5119:Dhx40 UTSW 11 86776636 missense probably damaging 0.99
R5416:Dhx40 UTSW 11 86797691 missense probably benign 0.01
R5531:Dhx40 UTSW 11 86789504 missense possibly damaging 0.45
R5677:Dhx40 UTSW 11 86800963 splice site probably null
R6270:Dhx40 UTSW 11 86799605 missense possibly damaging 0.85
R6431:Dhx40 UTSW 11 86773823 missense probably damaging 0.97
R6456:Dhx40 UTSW 11 86784974 missense probably damaging 1.00
R6594:Dhx40 UTSW 11 86785773 missense possibly damaging 0.74
R6599:Dhx40 UTSW 11 86804349 missense possibly damaging 0.51
R7069:Dhx40 UTSW 11 86797743 missense probably benign 0.06
R7268:Dhx40 UTSW 11 86806616 missense possibly damaging 0.86
R7470:Dhx40 UTSW 11 86776702 missense probably damaging 0.98
R7632:Dhx40 UTSW 11 86799437 missense probably benign 0.42
R7728:Dhx40 UTSW 11 86771933 missense probably damaging 0.98
R7788:Dhx40 UTSW 11 86775676 missense possibly damaging 0.86
R7869:Dhx40 UTSW 11 86797706 missense probably benign 0.02
R7889:Dhx40 UTSW 11 86798967 missense probably benign 0.01
R8046:Dhx40 UTSW 11 86784940 nonsense probably null
R8380:Dhx40 UTSW 11 86806585 missense probably damaging 1.00
R8691:Dhx40 UTSW 11 86799593 missense possibly damaging 0.63
X0021:Dhx40 UTSW 11 86773814 missense possibly damaging 0.84
X0066:Dhx40 UTSW 11 86806502 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- CAAAAGCAGAGATCTGGACAAGCACTAA -3'
(R):5'- CGTGGTGGGGAACAATGGTGATG -3'

Sequencing Primer
(F):5'- catacaagcaagcaaagcattc -3'
(R):5'- TGAGATGTAAGGAGAAACAGAACTTG -3'
Posted On2014-04-13