Incidental Mutation 'R1550:Mtmr4'
ID 169867
Institutional Source Beutler Lab
Gene Symbol Mtmr4
Ensembl Gene ENSMUSG00000018401
Gene Name myotubularin related protein 4
Synonyms ZFYVE11, FYVE-DSP2, ESTM44, FYVE zinc finger phosphatase
MMRRC Submission 039589-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.299) question?
Stock # R1550 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 87482988-87507128 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 87504342 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 1097 (D1097V)
Ref Sequence ENSEMBL: ENSMUSP00000112902 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092802] [ENSMUST00000093956] [ENSMUST00000103179] [ENSMUST00000119628]
AlphaFold Q91XS1
Predicted Effect probably damaging
Transcript: ENSMUST00000092802
AA Change: D1040V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000090478
Gene: ENSMUSG00000018401
AA Change: D1040V

DomainStartEndE-ValueType
Pfam:Myotub-related 126 507 4.2e-137 PFAM
low complexity region 933 945 N/A INTRINSIC
coiled coil region 961 991 N/A INTRINSIC
FYVE 1044 1113 2.08e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000093956
SMART Domains Protein: ENSMUSP00000091488
Gene: ENSMUSG00000070345

DomainStartEndE-ValueType
HSF 11 153 2.35e-9 SMART
Blast:HSF 163 423 1e-149 BLAST
low complexity region 442 457 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000103179
AA Change: D1097V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099468
Gene: ENSMUSG00000018401
AA Change: D1097V

DomainStartEndE-ValueType
Pfam:Myotub-related 126 521 8.1e-149 PFAM
low complexity region 990 1002 N/A INTRINSIC
coiled coil region 1018 1048 N/A INTRINSIC
FYVE 1101 1170 2.08e-31 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000119628
AA Change: D1097V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112902
Gene: ENSMUSG00000018401
AA Change: D1097V

DomainStartEndE-ValueType
Pfam:Myotub-related 127 519 1.5e-135 PFAM
low complexity region 990 1002 N/A INTRINSIC
coiled coil region 1018 1048 N/A INTRINSIC
FYVE 1101 1170 2.08e-31 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.4%
  • 20x: 89.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 A G 7: 45,654,668 (GRCm39) V551A probably benign Het
Acss1 A T 2: 150,484,715 (GRCm39) L176Q probably damaging Het
Aldh7a1 A G 18: 56,683,454 (GRCm39) I117T possibly damaging Het
Arf5 C T 6: 28,426,152 (GRCm39) R180C probably damaging Het
Arhgap21 A T 2: 20,886,576 (GRCm39) Y39* probably null Het
Arrdc1 A G 2: 24,816,351 (GRCm39) L206P probably damaging Het
Cby3 A T 11: 50,250,313 (GRCm39) Y173F probably damaging Het
Cdh18 T A 15: 23,436,634 (GRCm39) C497S probably damaging Het
Cyp11b2 T C 15: 74,725,442 (GRCm39) I226V probably benign Het
Ddit4l T A 3: 137,330,036 (GRCm39) probably null Het
Ddx11 C T 17: 66,445,215 (GRCm39) T405I probably benign Het
Dhx40 A T 11: 86,667,565 (GRCm39) probably null Het
Dlgap2 A G 8: 14,872,499 (GRCm39) D659G probably damaging Het
Eef2 A G 10: 81,016,681 (GRCm39) E586G probably benign Het
Fam161a A G 11: 22,970,470 (GRCm39) Q216R possibly damaging Het
Fbxw24 G T 9: 109,436,112 (GRCm39) R307S probably benign Het
Gbp2b G T 3: 142,312,591 (GRCm39) A325S probably damaging Het
Gli1 A T 10: 127,174,385 (GRCm39) F2Y probably damaging Het
Gnl2 T C 4: 124,938,027 (GRCm39) V269A probably damaging Het
Grin1 A G 2: 25,195,143 (GRCm39) V292A probably benign Het
Heg1 T A 16: 33,555,923 (GRCm39) V1001E probably damaging Het
Herc2 T A 7: 55,785,406 (GRCm39) I1552N probably damaging Het
Htr1a A G 13: 105,581,788 (GRCm39) T343A probably benign Het
Itk G T 11: 46,280,153 (GRCm39) R29S probably damaging Het
Ivns1abp G T 1: 151,237,242 (GRCm39) G469C probably damaging Het
Jph3 A T 8: 122,511,598 (GRCm39) N529Y possibly damaging Het
Kdm2b A G 5: 123,019,120 (GRCm39) L829P probably damaging Het
Kprp T A 3: 92,732,033 (GRCm39) Y339F probably damaging Het
Lrp2 A G 2: 69,333,005 (GRCm39) V1504A possibly damaging Het
Lypd6b A G 2: 49,833,615 (GRCm39) D85G probably damaging Het
Mansc4 T C 6: 146,977,136 (GRCm39) Y160C probably damaging Het
Mgll C A 6: 88,790,871 (GRCm39) H164N probably benign Het
Nfasc T C 1: 132,536,241 (GRCm39) K571E probably damaging Het
Nfat5 A T 8: 108,097,205 (GRCm39) N1527Y probably damaging Het
Nlgn1 A G 3: 25,966,808 (GRCm39) L215P probably damaging Het
Or6b9 T A 7: 106,555,235 (GRCm39) I303L probably benign Het
Pde4dip T C 3: 97,627,020 (GRCm39) S1173G probably damaging Het
Prrt3 A T 6: 113,472,468 (GRCm39) V568E probably damaging Het
Ptpra G A 2: 130,383,313 (GRCm39) R503Q possibly damaging Het
Pttg1ip2 C A 5: 5,502,019 (GRCm39) W144C probably benign Het
Rnf7l A G 10: 63,257,427 (GRCm39) L31P probably damaging Het
Sema5a G A 15: 32,618,995 (GRCm39) A508T probably benign Het
Serpinb11 T C 1: 107,307,418 (GRCm39) I283T possibly damaging Het
Setbp1 A T 18: 78,901,807 (GRCm39) L620Q probably damaging Het
Sipa1l3 A T 7: 29,082,628 (GRCm39) C756S probably benign Het
Sirpa A T 2: 129,471,961 (GRCm39) I463F probably damaging Het
Slc13a2 G T 11: 78,293,990 (GRCm39) N257K probably damaging Het
Slc4a5 C A 6: 83,248,039 (GRCm39) T530N probably damaging Het
Stab2 A T 10: 86,714,790 (GRCm39) F125L probably benign Het
Tet2 G T 3: 133,175,280 (GRCm39) Q1356K probably benign Het
Tet3 A T 6: 83,363,010 (GRCm39) S856T probably damaging Het
Tg C T 15: 66,565,279 (GRCm39) T1207I possibly damaging Het
Tkt A G 14: 30,287,525 (GRCm39) Y173C probably damaging Het
Tlr6 T A 5: 65,110,754 (GRCm39) I718F probably damaging Het
Tnfrsf11b A G 15: 54,117,454 (GRCm39) V267A possibly damaging Het
Ubqln3 T A 7: 103,790,753 (GRCm39) N446Y probably damaging Het
Vmn2r118 C T 17: 55,915,083 (GRCm39) C521Y probably damaging Het
Vps16 A G 2: 130,282,260 (GRCm39) D394G probably benign Het
Zfp236 A T 18: 82,692,549 (GRCm39) M142K possibly damaging Het
Zfp780b T C 7: 27,664,282 (GRCm39) D91G probably benign Het
Zfp97 T A 17: 17,365,468 (GRCm39) Y322* probably null Het
Other mutations in Mtmr4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Mtmr4 APN 11 87,502,750 (GRCm39) missense probably benign 0.29
IGL01134:Mtmr4 APN 11 87,494,893 (GRCm39) missense probably damaging 1.00
IGL01317:Mtmr4 APN 11 87,493,230 (GRCm39) unclassified probably benign
IGL01544:Mtmr4 APN 11 87,488,437 (GRCm39) splice site probably benign
IGL01574:Mtmr4 APN 11 87,491,473 (GRCm39) missense probably benign 0.01
IGL01807:Mtmr4 APN 11 87,494,976 (GRCm39) missense possibly damaging 0.55
IGL02059:Mtmr4 APN 11 87,491,950 (GRCm39) missense possibly damaging 0.66
IGL03049:Mtmr4 APN 11 87,505,060 (GRCm39) missense probably damaging 1.00
IGL03196:Mtmr4 APN 11 87,491,609 (GRCm39) missense possibly damaging 0.92
IGL03214:Mtmr4 APN 11 87,488,519 (GRCm39) missense probably damaging 1.00
IGL03258:Mtmr4 APN 11 87,502,829 (GRCm39) missense possibly damaging 0.63
Hippie UTSW 11 87,504,309 (GRCm39) missense probably damaging 1.00
incharge UTSW 11 87,501,868 (GRCm39) nonsense probably null
PIT4802001:Mtmr4 UTSW 11 87,501,953 (GRCm39) missense probably benign
R0009:Mtmr4 UTSW 11 87,502,334 (GRCm39) missense probably benign 0.02
R0564:Mtmr4 UTSW 11 87,489,714 (GRCm39) missense probably damaging 1.00
R0637:Mtmr4 UTSW 11 87,501,890 (GRCm39) missense probably benign 0.30
R0780:Mtmr4 UTSW 11 87,502,266 (GRCm39) missense probably benign 0.03
R1490:Mtmr4 UTSW 11 87,503,051 (GRCm39) missense probably damaging 1.00
R1777:Mtmr4 UTSW 11 87,493,656 (GRCm39) missense probably damaging 1.00
R1828:Mtmr4 UTSW 11 87,502,943 (GRCm39) missense probably benign 0.26
R2040:Mtmr4 UTSW 11 87,495,916 (GRCm39) missense probably damaging 1.00
R2088:Mtmr4 UTSW 11 87,501,793 (GRCm39) missense probably damaging 0.98
R2497:Mtmr4 UTSW 11 87,491,649 (GRCm39) missense probably damaging 1.00
R2993:Mtmr4 UTSW 11 87,495,823 (GRCm39) missense probably damaging 1.00
R3857:Mtmr4 UTSW 11 87,488,088 (GRCm39) missense probably damaging 0.98
R3858:Mtmr4 UTSW 11 87,488,088 (GRCm39) missense probably damaging 0.98
R4614:Mtmr4 UTSW 11 87,501,761 (GRCm39) missense probably damaging 0.99
R4615:Mtmr4 UTSW 11 87,501,761 (GRCm39) missense probably damaging 0.99
R4616:Mtmr4 UTSW 11 87,501,761 (GRCm39) missense probably damaging 0.99
R4816:Mtmr4 UTSW 11 87,494,923 (GRCm39) missense probably damaging 1.00
R5454:Mtmr4 UTSW 11 87,501,868 (GRCm39) nonsense probably null
R5502:Mtmr4 UTSW 11 87,504,904 (GRCm39) missense probably damaging 1.00
R5566:Mtmr4 UTSW 11 87,495,356 (GRCm39) missense probably damaging 1.00
R5833:Mtmr4 UTSW 11 87,495,875 (GRCm39) nonsense probably null
R5907:Mtmr4 UTSW 11 87,502,876 (GRCm39) missense probably damaging 0.99
R5980:Mtmr4 UTSW 11 87,494,977 (GRCm39) missense probably damaging 1.00
R6077:Mtmr4 UTSW 11 87,501,845 (GRCm39) missense probably damaging 1.00
R6434:Mtmr4 UTSW 11 87,504,309 (GRCm39) missense probably damaging 1.00
R6521:Mtmr4 UTSW 11 87,504,353 (GRCm39) missense possibly damaging 0.86
R7141:Mtmr4 UTSW 11 87,491,439 (GRCm39) missense probably damaging 1.00
R7182:Mtmr4 UTSW 11 87,495,431 (GRCm39) critical splice donor site probably null
R7290:Mtmr4 UTSW 11 87,502,063 (GRCm39) missense probably benign
R7350:Mtmr4 UTSW 11 87,491,476 (GRCm39) missense probably damaging 0.98
R7392:Mtmr4 UTSW 11 87,495,383 (GRCm39) missense probably damaging 1.00
R7447:Mtmr4 UTSW 11 87,502,727 (GRCm39) missense probably damaging 1.00
R7530:Mtmr4 UTSW 11 87,502,702 (GRCm39) missense probably damaging 1.00
R7660:Mtmr4 UTSW 11 87,495,406 (GRCm39) missense probably damaging 0.99
R7713:Mtmr4 UTSW 11 87,488,550 (GRCm39) missense probably damaging 1.00
R7823:Mtmr4 UTSW 11 87,503,015 (GRCm39) missense probably damaging 1.00
R7944:Mtmr4 UTSW 11 87,495,254 (GRCm39) missense probably damaging 1.00
R7945:Mtmr4 UTSW 11 87,495,254 (GRCm39) missense probably damaging 1.00
R8010:Mtmr4 UTSW 11 87,489,690 (GRCm39) missense probably damaging 1.00
R8116:Mtmr4 UTSW 11 87,502,756 (GRCm39) nonsense probably null
R8544:Mtmr4 UTSW 11 87,502,735 (GRCm39) missense possibly damaging 0.86
R8559:Mtmr4 UTSW 11 87,494,950 (GRCm39) missense probably damaging 1.00
R8971:Mtmr4 UTSW 11 87,493,626 (GRCm39) missense probably benign 0.13
R9562:Mtmr4 UTSW 11 87,493,241 (GRCm39) missense probably damaging 1.00
R9673:Mtmr4 UTSW 11 87,504,916 (GRCm39) missense probably damaging 1.00
R9673:Mtmr4 UTSW 11 87,503,138 (GRCm39) missense probably damaging 1.00
R9797:Mtmr4 UTSW 11 87,494,962 (GRCm39) missense probably damaging 1.00
X0062:Mtmr4 UTSW 11 87,502,651 (GRCm39) missense probably damaging 0.99
Z1177:Mtmr4 UTSW 11 87,502,706 (GRCm39) missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- TGAGGGCCATCTAGGCTTTACTGTC -3'
(R):5'- ACGATTGGTGACTACTTGCCTAAAAGG -3'

Sequencing Primer
(F):5'- gacacaaaagcagccagag -3'
(R):5'- CCTAAAAGGATAGTACTTATCTGGGG -3'
Posted On 2014-04-13