Incidental Mutation 'R1550:Htr1a'
ID169868
Institutional Source Beutler Lab
Gene Symbol Htr1a
Ensembl Gene ENSMUSG00000021721
Gene Name5-hydroxytryptamine (serotonin) receptor 1A
Synonyms5-HT1A receptor, Gpcr18
MMRRC Submission 039589-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1550 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location105443639-105448122 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 105445280 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 343 (T343A)
Ref Sequence ENSEMBL: ENSMUSP00000022235 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022235]
Predicted Effect probably benign
Transcript: ENSMUST00000022235
AA Change: T343A

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000022235
Gene: ENSMUSG00000021721
AA Change: T343A

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 45 174 2.7e-5 PFAM
Pfam:7TM_GPCR_Srsx 47 236 8e-8 PFAM
Pfam:7tm_1 53 400 1.3e-88 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.4%
  • 20x: 89.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a G protein-coupled receptor for 5-hydroxytryptamine (serotonin), and belongs to the 5-hydroxytryptamine receptor subfamily. Serotonin has been implicated in a number of physiologic processes and pathologic conditions. Inactivation of this gene in mice results in behavior consistent with an increased anxiety and stress response. Mutation in the promoter of this gene has been associated with menstrual cycle-dependent periodic fevers. [provided by RefSeq, Jun 2012]
PHENOTYPE: Homozygotes for targeted null mutations show a common phenotype, including augmented anxious-like behavior in the elevated plus-maze, open-field, and novel object tests, reduced immobility in the forced-swim or tail-suspension test, and changes in density of 5-HTT binding in several brain regions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik C A 5: 5,452,019 W144C probably benign Het
Abcc6 A G 7: 46,005,244 V551A probably benign Het
Acss1 A T 2: 150,642,795 L176Q probably damaging Het
Aldh7a1 A G 18: 56,550,382 I117T possibly damaging Het
Arf5 C T 6: 28,426,153 R180C probably damaging Het
Arhgap21 A T 2: 20,881,765 Y39* probably null Het
Arrdc1 A G 2: 24,926,339 L206P probably damaging Het
Cby3 A T 11: 50,359,486 Y173F probably damaging Het
Cdh18 T A 15: 23,436,548 C497S probably damaging Het
Cyp11b2 T C 15: 74,853,593 I226V probably benign Het
Ddit4l T A 3: 137,624,275 probably null Het
Ddx11 C T 17: 66,138,220 T405I probably benign Het
Dhx40 A T 11: 86,776,739 probably null Het
Dlgap2 A G 8: 14,822,499 D659G probably damaging Het
Eef2 A G 10: 81,180,847 E586G probably benign Het
Fam161a A G 11: 23,020,470 Q216R possibly damaging Het
Fbxw24 G T 9: 109,607,044 R307S probably benign Het
Gbp2b G T 3: 142,606,830 A325S probably damaging Het
Gli1 A T 10: 127,338,516 F2Y probably damaging Het
Gm7075 A G 10: 63,421,648 L31P probably damaging Het
Gnl2 T C 4: 125,044,234 V269A probably damaging Het
Grin1 A G 2: 25,305,131 V292A probably benign Het
Heg1 T A 16: 33,735,553 V1001E probably damaging Het
Herc2 T A 7: 56,135,658 I1552N probably damaging Het
Itk G T 11: 46,389,326 R29S probably damaging Het
Ivns1abp G T 1: 151,361,491 G469C probably damaging Het
Jph3 A T 8: 121,784,859 N529Y possibly damaging Het
Kdm2b A G 5: 122,881,057 L829P probably damaging Het
Kprp T A 3: 92,824,726 Y339F probably damaging Het
Lrp2 A G 2: 69,502,661 V1504A possibly damaging Het
Lypd6b A G 2: 49,943,603 D85G probably damaging Het
Mansc4 T C 6: 147,075,638 Y160C probably damaging Het
Mgll C A 6: 88,813,889 H164N probably benign Het
Mtmr4 A T 11: 87,613,516 D1097V probably damaging Het
Nfasc T C 1: 132,608,503 K571E probably damaging Het
Nfat5 A T 8: 107,370,573 N1527Y probably damaging Het
Nlgn1 A G 3: 25,912,644 L215P probably damaging Het
Olfr6 T A 7: 106,956,028 I303L probably benign Het
Pde4dip T C 3: 97,719,704 S1173G probably damaging Het
Prrt3 A T 6: 113,495,507 V568E probably damaging Het
Ptpra G A 2: 130,541,393 R503Q possibly damaging Het
Sema5a G A 15: 32,618,849 A508T probably benign Het
Serpinb11 T C 1: 107,379,688 I283T possibly damaging Het
Setbp1 A T 18: 78,858,592 L620Q probably damaging Het
Sipa1l3 A T 7: 29,383,203 C756S probably benign Het
Sirpa A T 2: 129,630,041 I463F probably damaging Het
Slc13a2 G T 11: 78,403,164 N257K probably damaging Het
Slc4a5 C A 6: 83,271,057 T530N probably damaging Het
Stab2 A T 10: 86,878,926 F125L probably benign Het
Tet2 G T 3: 133,469,519 Q1356K probably benign Het
Tet3 A T 6: 83,386,028 S856T probably damaging Het
Tg C T 15: 66,693,430 T1207I possibly damaging Het
Tkt A G 14: 30,565,568 Y173C probably damaging Het
Tlr6 T A 5: 64,953,411 I718F probably damaging Het
Tnfrsf11b A G 15: 54,254,058 V267A possibly damaging Het
Ubqln3 T A 7: 104,141,546 N446Y probably damaging Het
Vmn2r118 C T 17: 55,608,083 C521Y probably damaging Het
Vps16 A G 2: 130,440,340 D394G probably benign Het
Zfp236 A T 18: 82,674,424 M142K possibly damaging Het
Zfp780b T C 7: 27,964,857 D91G probably benign Het
Zfp97 T A 17: 17,145,206 Y322* probably null Het
Other mutations in Htr1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01135:Htr1a APN 13 105445284 missense possibly damaging 0.88
R0578:Htr1a UTSW 13 105445087 missense probably damaging 1.00
R0919:Htr1a UTSW 13 105444836 missense probably damaging 1.00
R0962:Htr1a UTSW 13 105444324 missense probably benign 0.02
R1143:Htr1a UTSW 13 105445068 missense probably benign
R1349:Htr1a UTSW 13 105445366 nonsense probably null
R2520:Htr1a UTSW 13 105445373 missense probably benign 0.43
R3794:Htr1a UTSW 13 105444344 missense possibly damaging 0.59
R6679:Htr1a UTSW 13 105445428 missense probably damaging 1.00
R6844:Htr1a UTSW 13 105444947 missense possibly damaging 0.94
R7680:Htr1a UTSW 13 105445031 missense probably benign
Z1177:Htr1a UTSW 13 105444876 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAAGAAGAGCCTGAATGGTCAGC -3'
(R):5'- GCGGCAGAACTTGCACTTGATG -3'

Sequencing Primer
(F):5'- CCTGAATGGTCAGCCAGGTAG -3'
(R):5'- CAGAACTTGCACTTGATGATCTTC -3'
Posted On2014-04-13