Incidental Mutation 'R1550:Tkt'
ID169869
Institutional Source Beutler Lab
Gene Symbol Tkt
Ensembl Gene ENSMUSG00000021957
Gene Nametransketolase
Synonymsp68
MMRRC Submission 039589-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1550 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location30548359-30574720 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 30565568 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 173 (Y173C)
Ref Sequence ENSEMBL: ENSMUSP00000022529 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022529] [ENSMUST00000162356]
Predicted Effect probably damaging
Transcript: ENSMUST00000022529
AA Change: Y173C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022529
Gene: ENSMUSG00000021957
AA Change: Y173C

DomainStartEndE-ValueType
Pfam:Transketolase_N 14 284 1.4e-46 PFAM
Pfam:E1_dh 108 239 6.9e-11 PFAM
Transket_pyr 315 479 1.52e-42 SMART
Pfam:Transketolase_C 490 612 3.9e-35 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160189
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160406
Predicted Effect probably benign
Transcript: ENSMUST00000162356
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223633
Predicted Effect unknown
Transcript: ENSMUST00000223717
AA Change: Y145C
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225039
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225857
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.4%
  • 20x: 89.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes an enzyme that binds magnesium and thiamine pyrophosphate and catalyzes the transfer of sugar phosphates to an aldose acceptor. This enzyme is a key component of the pentose phosphate pathway during glycolysis. It is significantly expressed in the cornea and may be involved in the cellular response against oxidative stress. Haploinsufficiency of this gene leads to decreased growth and reduction of adipose tissue. [provided by RefSeq, Dec 2013]
PHENOTYPE: Homozygotes for a targeted null mutation die at or before the morula stage. Heterozygotes show reduced growth, decreased fat accumulation, microphthalmia, and reduced female fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik C A 5: 5,452,019 W144C probably benign Het
Abcc6 A G 7: 46,005,244 V551A probably benign Het
Acss1 A T 2: 150,642,795 L176Q probably damaging Het
Aldh7a1 A G 18: 56,550,382 I117T possibly damaging Het
Arf5 C T 6: 28,426,153 R180C probably damaging Het
Arhgap21 A T 2: 20,881,765 Y39* probably null Het
Arrdc1 A G 2: 24,926,339 L206P probably damaging Het
Cby3 A T 11: 50,359,486 Y173F probably damaging Het
Cdh18 T A 15: 23,436,548 C497S probably damaging Het
Cyp11b2 T C 15: 74,853,593 I226V probably benign Het
Ddit4l T A 3: 137,624,275 probably null Het
Ddx11 C T 17: 66,138,220 T405I probably benign Het
Dhx40 A T 11: 86,776,739 probably null Het
Dlgap2 A G 8: 14,822,499 D659G probably damaging Het
Eef2 A G 10: 81,180,847 E586G probably benign Het
Fam161a A G 11: 23,020,470 Q216R possibly damaging Het
Fbxw24 G T 9: 109,607,044 R307S probably benign Het
Gbp2b G T 3: 142,606,830 A325S probably damaging Het
Gli1 A T 10: 127,338,516 F2Y probably damaging Het
Gm7075 A G 10: 63,421,648 L31P probably damaging Het
Gnl2 T C 4: 125,044,234 V269A probably damaging Het
Grin1 A G 2: 25,305,131 V292A probably benign Het
Heg1 T A 16: 33,735,553 V1001E probably damaging Het
Herc2 T A 7: 56,135,658 I1552N probably damaging Het
Htr1a A G 13: 105,445,280 T343A probably benign Het
Itk G T 11: 46,389,326 R29S probably damaging Het
Ivns1abp G T 1: 151,361,491 G469C probably damaging Het
Jph3 A T 8: 121,784,859 N529Y possibly damaging Het
Kdm2b A G 5: 122,881,057 L829P probably damaging Het
Kprp T A 3: 92,824,726 Y339F probably damaging Het
Lrp2 A G 2: 69,502,661 V1504A possibly damaging Het
Lypd6b A G 2: 49,943,603 D85G probably damaging Het
Mansc4 T C 6: 147,075,638 Y160C probably damaging Het
Mgll C A 6: 88,813,889 H164N probably benign Het
Mtmr4 A T 11: 87,613,516 D1097V probably damaging Het
Nfasc T C 1: 132,608,503 K571E probably damaging Het
Nfat5 A T 8: 107,370,573 N1527Y probably damaging Het
Nlgn1 A G 3: 25,912,644 L215P probably damaging Het
Olfr6 T A 7: 106,956,028 I303L probably benign Het
Pde4dip T C 3: 97,719,704 S1173G probably damaging Het
Prrt3 A T 6: 113,495,507 V568E probably damaging Het
Ptpra G A 2: 130,541,393 R503Q possibly damaging Het
Sema5a G A 15: 32,618,849 A508T probably benign Het
Serpinb11 T C 1: 107,379,688 I283T possibly damaging Het
Setbp1 A T 18: 78,858,592 L620Q probably damaging Het
Sipa1l3 A T 7: 29,383,203 C756S probably benign Het
Sirpa A T 2: 129,630,041 I463F probably damaging Het
Slc13a2 G T 11: 78,403,164 N257K probably damaging Het
Slc4a5 C A 6: 83,271,057 T530N probably damaging Het
Stab2 A T 10: 86,878,926 F125L probably benign Het
Tet2 G T 3: 133,469,519 Q1356K probably benign Het
Tet3 A T 6: 83,386,028 S856T probably damaging Het
Tg C T 15: 66,693,430 T1207I possibly damaging Het
Tlr6 T A 5: 64,953,411 I718F probably damaging Het
Tnfrsf11b A G 15: 54,254,058 V267A possibly damaging Het
Ubqln3 T A 7: 104,141,546 N446Y probably damaging Het
Vmn2r118 C T 17: 55,608,083 C521Y probably damaging Het
Vps16 A G 2: 130,440,340 D394G probably benign Het
Zfp236 A T 18: 82,674,424 M142K possibly damaging Het
Zfp780b T C 7: 27,964,857 D91G probably benign Het
Zfp97 T A 17: 17,145,206 Y322* probably null Het
Other mutations in Tkt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00954:Tkt APN 14 30569095 missense probably damaging 1.00
IGL02122:Tkt APN 14 30571201 missense possibly damaging 0.95
IGL02323:Tkt APN 14 30571035 missense possibly damaging 0.69
IGL02326:Tkt APN 14 30572225 missense probably damaging 0.99
IGL02554:Tkt APN 14 30558780 missense probably damaging 1.00
IGL03145:Tkt APN 14 30560688 splice site probably benign
R0148:Tkt UTSW 14 30572220 missense probably damaging 1.00
R0732:Tkt UTSW 14 30571140 splice site probably null
R2218:Tkt UTSW 14 30567061 critical splice donor site probably null
R4464:Tkt UTSW 14 30568274 missense possibly damaging 0.86
R4771:Tkt UTSW 14 30567025 missense probably damaging 0.97
R4998:Tkt UTSW 14 30565542 nonsense probably null
R5123:Tkt UTSW 14 30565646 missense probably benign 0.11
R5240:Tkt UTSW 14 30565678 missense probably damaging 1.00
R5283:Tkt UTSW 14 30560618 missense probably damaging 1.00
R5777:Tkt UTSW 14 30558776 missense possibly damaging 0.88
R6051:Tkt UTSW 14 30568196 missense probably benign 0.27
R6517:Tkt UTSW 14 30549323 missense probably damaging 0.96
R6645:Tkt UTSW 14 30570211 missense probably damaging 1.00
R6722:Tkt UTSW 14 30569084 missense probably damaging 1.00
R7120:Tkt UTSW 14 30559822 missense probably benign 0.03
R7179:Tkt UTSW 14 30559858 missense probably damaging 1.00
R7272:Tkt UTSW 14 30565607 missense probably damaging 1.00
R7274:Tkt UTSW 14 30569145 splice site probably null
R7402:Tkt UTSW 14 30558798 missense probably damaging 1.00
R7423:Tkt UTSW 14 30571035 missense possibly damaging 0.69
R7522:Tkt UTSW 14 30568223 missense possibly damaging 0.52
R7712:Tkt UTSW 14 30558806 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTCAAAGGAGCCTGCCTCTGAGAC -3'
(R):5'- ATCCTCACGGTCAACTTACGGAGC -3'

Sequencing Primer
(F):5'- GATCCTAGTGATACTGATGACCC -3'
(R):5'- CTAGGTGGTAGGCTGTACAACC -3'
Posted On2014-04-13