Incidental Mutation 'R1550:Vmn2r118'
ID 169878
Institutional Source Beutler Lab
Gene Symbol Vmn2r118
Ensembl Gene ENSMUSG00000091504
Gene Name vomeronasal 2, receptor 118
Synonyms Vmn2r119, EG668547, EG383258
MMRRC Submission 039589-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.128) question?
Stock # R1550 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 55899341-55931672 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 55915083 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Tyrosine at position 521 (C521Y)
Ref Sequence ENSEMBL: ENSMUSP00000131128 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168440]
AlphaFold E9Q1C1
Predicted Effect probably damaging
Transcript: ENSMUST00000168440
AA Change: C521Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131128
Gene: ENSMUSG00000091504
AA Change: C521Y

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 142 470 4.6e-27 PFAM
Pfam:NCD3G 513 566 2.6e-20 PFAM
Pfam:7tm_3 599 834 5.9e-55 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.4%
  • 20x: 89.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 A G 7: 45,654,668 (GRCm39) V551A probably benign Het
Acss1 A T 2: 150,484,715 (GRCm39) L176Q probably damaging Het
Aldh7a1 A G 18: 56,683,454 (GRCm39) I117T possibly damaging Het
Arf5 C T 6: 28,426,152 (GRCm39) R180C probably damaging Het
Arhgap21 A T 2: 20,886,576 (GRCm39) Y39* probably null Het
Arrdc1 A G 2: 24,816,351 (GRCm39) L206P probably damaging Het
Cby3 A T 11: 50,250,313 (GRCm39) Y173F probably damaging Het
Cdh18 T A 15: 23,436,634 (GRCm39) C497S probably damaging Het
Cyp11b2 T C 15: 74,725,442 (GRCm39) I226V probably benign Het
Ddit4l T A 3: 137,330,036 (GRCm39) probably null Het
Ddx11 C T 17: 66,445,215 (GRCm39) T405I probably benign Het
Dhx40 A T 11: 86,667,565 (GRCm39) probably null Het
Dlgap2 A G 8: 14,872,499 (GRCm39) D659G probably damaging Het
Eef2 A G 10: 81,016,681 (GRCm39) E586G probably benign Het
Fam161a A G 11: 22,970,470 (GRCm39) Q216R possibly damaging Het
Fbxw24 G T 9: 109,436,112 (GRCm39) R307S probably benign Het
Gbp2b G T 3: 142,312,591 (GRCm39) A325S probably damaging Het
Gli1 A T 10: 127,174,385 (GRCm39) F2Y probably damaging Het
Gnl2 T C 4: 124,938,027 (GRCm39) V269A probably damaging Het
Grin1 A G 2: 25,195,143 (GRCm39) V292A probably benign Het
Heg1 T A 16: 33,555,923 (GRCm39) V1001E probably damaging Het
Herc2 T A 7: 55,785,406 (GRCm39) I1552N probably damaging Het
Htr1a A G 13: 105,581,788 (GRCm39) T343A probably benign Het
Itk G T 11: 46,280,153 (GRCm39) R29S probably damaging Het
Ivns1abp G T 1: 151,237,242 (GRCm39) G469C probably damaging Het
Jph3 A T 8: 122,511,598 (GRCm39) N529Y possibly damaging Het
Kdm2b A G 5: 123,019,120 (GRCm39) L829P probably damaging Het
Kprp T A 3: 92,732,033 (GRCm39) Y339F probably damaging Het
Lrp2 A G 2: 69,333,005 (GRCm39) V1504A possibly damaging Het
Lypd6b A G 2: 49,833,615 (GRCm39) D85G probably damaging Het
Mansc4 T C 6: 146,977,136 (GRCm39) Y160C probably damaging Het
Mgll C A 6: 88,790,871 (GRCm39) H164N probably benign Het
Mtmr4 A T 11: 87,504,342 (GRCm39) D1097V probably damaging Het
Nfasc T C 1: 132,536,241 (GRCm39) K571E probably damaging Het
Nfat5 A T 8: 108,097,205 (GRCm39) N1527Y probably damaging Het
Nlgn1 A G 3: 25,966,808 (GRCm39) L215P probably damaging Het
Or6b9 T A 7: 106,555,235 (GRCm39) I303L probably benign Het
Pde4dip T C 3: 97,627,020 (GRCm39) S1173G probably damaging Het
Prrt3 A T 6: 113,472,468 (GRCm39) V568E probably damaging Het
Ptpra G A 2: 130,383,313 (GRCm39) R503Q possibly damaging Het
Pttg1ip2 C A 5: 5,502,019 (GRCm39) W144C probably benign Het
Rnf7l A G 10: 63,257,427 (GRCm39) L31P probably damaging Het
Sema5a G A 15: 32,618,995 (GRCm39) A508T probably benign Het
Serpinb11 T C 1: 107,307,418 (GRCm39) I283T possibly damaging Het
Setbp1 A T 18: 78,901,807 (GRCm39) L620Q probably damaging Het
Sipa1l3 A T 7: 29,082,628 (GRCm39) C756S probably benign Het
Sirpa A T 2: 129,471,961 (GRCm39) I463F probably damaging Het
Slc13a2 G T 11: 78,293,990 (GRCm39) N257K probably damaging Het
Slc4a5 C A 6: 83,248,039 (GRCm39) T530N probably damaging Het
Stab2 A T 10: 86,714,790 (GRCm39) F125L probably benign Het
Tet2 G T 3: 133,175,280 (GRCm39) Q1356K probably benign Het
Tet3 A T 6: 83,363,010 (GRCm39) S856T probably damaging Het
Tg C T 15: 66,565,279 (GRCm39) T1207I possibly damaging Het
Tkt A G 14: 30,287,525 (GRCm39) Y173C probably damaging Het
Tlr6 T A 5: 65,110,754 (GRCm39) I718F probably damaging Het
Tnfrsf11b A G 15: 54,117,454 (GRCm39) V267A possibly damaging Het
Ubqln3 T A 7: 103,790,753 (GRCm39) N446Y probably damaging Het
Vps16 A G 2: 130,282,260 (GRCm39) D394G probably benign Het
Zfp236 A T 18: 82,692,549 (GRCm39) M142K possibly damaging Het
Zfp780b T C 7: 27,664,282 (GRCm39) D91G probably benign Het
Zfp97 T A 17: 17,365,468 (GRCm39) Y322* probably null Het
Other mutations in Vmn2r118
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Vmn2r118 APN 17 55,899,708 (GRCm39) missense probably damaging 1.00
IGL00976:Vmn2r118 APN 17 55,900,204 (GRCm39) missense probably damaging 1.00
IGL01419:Vmn2r118 APN 17 55,900,000 (GRCm39) missense probably benign 0.01
IGL01796:Vmn2r118 APN 17 55,915,585 (GRCm39) missense probably benign 0.30
IGL01799:Vmn2r118 APN 17 55,899,990 (GRCm39) missense probably damaging 1.00
IGL02002:Vmn2r118 APN 17 55,899,619 (GRCm39) missense probably damaging 1.00
IGL02075:Vmn2r118 APN 17 55,917,517 (GRCm39) missense probably benign 0.18
IGL02172:Vmn2r118 APN 17 55,931,598 (GRCm39) missense probably benign 0.00
IGL02529:Vmn2r118 APN 17 55,917,870 (GRCm39) missense possibly damaging 0.58
IGL02712:Vmn2r118 APN 17 55,899,655 (GRCm39) missense probably benign 0.21
IGL03096:Vmn2r118 APN 17 55,914,996 (GRCm39) missense probably damaging 1.00
R0306:Vmn2r118 UTSW 17 55,915,616 (GRCm39) missense possibly damaging 0.89
R0329:Vmn2r118 UTSW 17 55,917,717 (GRCm39) missense probably damaging 1.00
R0330:Vmn2r118 UTSW 17 55,917,717 (GRCm39) missense probably damaging 1.00
R0396:Vmn2r118 UTSW 17 55,915,643 (GRCm39) missense probably benign 0.00
R0411:Vmn2r118 UTSW 17 55,918,021 (GRCm39) splice site probably benign
R0513:Vmn2r118 UTSW 17 55,917,970 (GRCm39) nonsense probably null
R0627:Vmn2r118 UTSW 17 55,917,772 (GRCm39) missense probably benign 0.01
R0638:Vmn2r118 UTSW 17 55,915,466 (GRCm39) missense probably benign 0.03
R1328:Vmn2r118 UTSW 17 55,915,620 (GRCm39) missense probably benign 0.01
R1366:Vmn2r118 UTSW 17 55,900,237 (GRCm39) nonsense probably null
R1465:Vmn2r118 UTSW 17 55,917,935 (GRCm39) missense probably benign 0.33
R1465:Vmn2r118 UTSW 17 55,917,935 (GRCm39) missense probably benign 0.33
R1511:Vmn2r118 UTSW 17 55,915,496 (GRCm39) nonsense probably null
R1515:Vmn2r118 UTSW 17 55,917,643 (GRCm39) missense probably benign 0.25
R1779:Vmn2r118 UTSW 17 55,918,530 (GRCm39) missense probably benign 0.03
R1834:Vmn2r118 UTSW 17 55,899,456 (GRCm39) missense probably damaging 1.00
R1840:Vmn2r118 UTSW 17 55,917,406 (GRCm39) nonsense probably null
R1854:Vmn2r118 UTSW 17 55,918,556 (GRCm39) missense possibly damaging 0.57
R1967:Vmn2r118 UTSW 17 55,899,882 (GRCm39) missense probably damaging 1.00
R1976:Vmn2r118 UTSW 17 55,899,925 (GRCm39) missense probably damaging 1.00
R2308:Vmn2r118 UTSW 17 55,931,650 (GRCm39) missense probably benign 0.33
R3700:Vmn2r118 UTSW 17 55,915,421 (GRCm39) missense possibly damaging 0.68
R4334:Vmn2r118 UTSW 17 55,917,347 (GRCm39) missense possibly damaging 0.58
R4647:Vmn2r118 UTSW 17 55,917,665 (GRCm39) missense probably damaging 1.00
R4709:Vmn2r118 UTSW 17 55,917,860 (GRCm39) missense probably damaging 1.00
R4805:Vmn2r118 UTSW 17 55,899,581 (GRCm39) missense probably damaging 1.00
R4858:Vmn2r118 UTSW 17 55,899,894 (GRCm39) missense probably damaging 0.98
R5384:Vmn2r118 UTSW 17 55,918,565 (GRCm39) missense probably benign 0.00
R5385:Vmn2r118 UTSW 17 55,918,565 (GRCm39) missense probably benign 0.00
R5664:Vmn2r118 UTSW 17 55,899,765 (GRCm39) missense possibly damaging 0.46
R5740:Vmn2r118 UTSW 17 55,900,103 (GRCm39) missense probably benign 0.00
R5927:Vmn2r118 UTSW 17 55,931,494 (GRCm39) missense probably benign 0.04
R6143:Vmn2r118 UTSW 17 55,899,871 (GRCm39) missense possibly damaging 0.92
R6513:Vmn2r118 UTSW 17 55,915,093 (GRCm39) missense probably damaging 1.00
R6573:Vmn2r118 UTSW 17 55,899,996 (GRCm39) missense probably damaging 1.00
R6760:Vmn2r118 UTSW 17 55,899,714 (GRCm39) missense possibly damaging 0.92
R6794:Vmn2r118 UTSW 17 55,899,348 (GRCm39) missense possibly damaging 0.48
R6929:Vmn2r118 UTSW 17 55,917,440 (GRCm39) missense probably benign 0.01
R7201:Vmn2r118 UTSW 17 55,915,496 (GRCm39) nonsense probably null
R7539:Vmn2r118 UTSW 17 55,899,853 (GRCm39) missense probably damaging 0.98
R7836:Vmn2r118 UTSW 17 55,900,242 (GRCm39) missense probably damaging 0.99
R8179:Vmn2r118 UTSW 17 55,915,484 (GRCm39) missense probably benign 0.36
R8248:Vmn2r118 UTSW 17 55,917,936 (GRCm39) missense probably benign 0.18
R8347:Vmn2r118 UTSW 17 55,917,423 (GRCm39) missense possibly damaging 0.94
R8415:Vmn2r118 UTSW 17 55,915,057 (GRCm39) missense probably benign 0.08
R8428:Vmn2r118 UTSW 17 55,915,642 (GRCm39) missense probably benign 0.33
R8917:Vmn2r118 UTSW 17 55,917,216 (GRCm39) missense possibly damaging 0.82
R8993:Vmn2r118 UTSW 17 55,917,835 (GRCm39) missense possibly damaging 0.72
R9038:Vmn2r118 UTSW 17 55,918,649 (GRCm39) missense probably damaging 1.00
R9155:Vmn2r118 UTSW 17 55,917,207 (GRCm39) missense probably null 0.83
R9603:Vmn2r118 UTSW 17 55,899,837 (GRCm39) missense probably damaging 1.00
R9742:Vmn2r118 UTSW 17 55,918,009 (GRCm39) missense probably damaging 0.98
R9749:Vmn2r118 UTSW 17 55,915,415 (GRCm39) critical splice donor site probably null
R9792:Vmn2r118 UTSW 17 55,899,496 (GRCm39) missense probably damaging 0.99
R9793:Vmn2r118 UTSW 17 55,899,496 (GRCm39) missense probably damaging 0.99
R9795:Vmn2r118 UTSW 17 55,899,496 (GRCm39) missense probably damaging 0.99
X0022:Vmn2r118 UTSW 17 55,900,218 (GRCm39) missense probably damaging 1.00
Z1176:Vmn2r118 UTSW 17 55,917,655 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTTGTCTCTTCATtgtcccgccc -3'
(R):5'- AGGTGAGTTTGGCCCAACTTAATGTTTT -3'

Sequencing Primer
(F):5'- agggtatggggaggggg -3'
(R):5'- GGCCCAACTTAATGTTTTACAAGTAG -3'
Posted On 2014-04-13