Incidental Mutation 'R1550:Ddx11'
ID169879
Institutional Source Beutler Lab
Gene Symbol Ddx11
Ensembl Gene ENSMUSG00000035842
Gene NameDEAD/H (Asp-Glu-Ala-Asp/His) box helicase 11
SynonymsCHL1, 4732462I11Rik, CHLR1, essa15a, KRG2
MMRRC Submission 039589-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1550 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location66123520-66152174 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 66138220 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 405 (T405I)
Ref Sequence ENSEMBL: ENSMUSP00000153436 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163605] [ENSMUST00000224497] [ENSMUST00000224903]
Predicted Effect probably benign
Transcript: ENSMUST00000163605
AA Change: T379I

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000130440
Gene: ENSMUSG00000035842
AA Change: T379I

DomainStartEndE-ValueType
DEXDc 11 408 1.14e-153 SMART
Blast:DEXDc2 430 479 6e-14 BLAST
HELICc 682 839 1.4e-66 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223801
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223805
Predicted Effect probably benign
Transcript: ENSMUST00000224497
AA Change: T405I

PolyPhen 2 Score 0.155 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably benign
Transcript: ENSMUST00000224903
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225687
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.4%
  • 20x: 89.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein, which is an enzyme that possesses both ATPase and DNA helicase activities. This gene is a homolog of the yeast CHL1 gene, and may function to maintain chromosome transmission fidelity and genome stability. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit lethality before E11.5 with growth retardation, failure of chorioallantoic fusion, poor placental labyrinth development, and embryonic cell physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik C A 5: 5,452,019 W144C probably benign Het
Abcc6 A G 7: 46,005,244 V551A probably benign Het
Acss1 A T 2: 150,642,795 L176Q probably damaging Het
Aldh7a1 A G 18: 56,550,382 I117T possibly damaging Het
Arf5 C T 6: 28,426,153 R180C probably damaging Het
Arhgap21 A T 2: 20,881,765 Y39* probably null Het
Arrdc1 A G 2: 24,926,339 L206P probably damaging Het
Cby3 A T 11: 50,359,486 Y173F probably damaging Het
Cdh18 T A 15: 23,436,548 C497S probably damaging Het
Cyp11b2 T C 15: 74,853,593 I226V probably benign Het
Ddit4l T A 3: 137,624,275 probably null Het
Dhx40 A T 11: 86,776,739 probably null Het
Dlgap2 A G 8: 14,822,499 D659G probably damaging Het
Eef2 A G 10: 81,180,847 E586G probably benign Het
Fam161a A G 11: 23,020,470 Q216R possibly damaging Het
Fbxw24 G T 9: 109,607,044 R307S probably benign Het
Gbp2b G T 3: 142,606,830 A325S probably damaging Het
Gli1 A T 10: 127,338,516 F2Y probably damaging Het
Gm7075 A G 10: 63,421,648 L31P probably damaging Het
Gnl2 T C 4: 125,044,234 V269A probably damaging Het
Grin1 A G 2: 25,305,131 V292A probably benign Het
Heg1 T A 16: 33,735,553 V1001E probably damaging Het
Herc2 T A 7: 56,135,658 I1552N probably damaging Het
Htr1a A G 13: 105,445,280 T343A probably benign Het
Itk G T 11: 46,389,326 R29S probably damaging Het
Ivns1abp G T 1: 151,361,491 G469C probably damaging Het
Jph3 A T 8: 121,784,859 N529Y possibly damaging Het
Kdm2b A G 5: 122,881,057 L829P probably damaging Het
Kprp T A 3: 92,824,726 Y339F probably damaging Het
Lrp2 A G 2: 69,502,661 V1504A possibly damaging Het
Lypd6b A G 2: 49,943,603 D85G probably damaging Het
Mansc4 T C 6: 147,075,638 Y160C probably damaging Het
Mgll C A 6: 88,813,889 H164N probably benign Het
Mtmr4 A T 11: 87,613,516 D1097V probably damaging Het
Nfasc T C 1: 132,608,503 K571E probably damaging Het
Nfat5 A T 8: 107,370,573 N1527Y probably damaging Het
Nlgn1 A G 3: 25,912,644 L215P probably damaging Het
Olfr6 T A 7: 106,956,028 I303L probably benign Het
Pde4dip T C 3: 97,719,704 S1173G probably damaging Het
Prrt3 A T 6: 113,495,507 V568E probably damaging Het
Ptpra G A 2: 130,541,393 R503Q possibly damaging Het
Sema5a G A 15: 32,618,849 A508T probably benign Het
Serpinb11 T C 1: 107,379,688 I283T possibly damaging Het
Setbp1 A T 18: 78,858,592 L620Q probably damaging Het
Sipa1l3 A T 7: 29,383,203 C756S probably benign Het
Sirpa A T 2: 129,630,041 I463F probably damaging Het
Slc13a2 G T 11: 78,403,164 N257K probably damaging Het
Slc4a5 C A 6: 83,271,057 T530N probably damaging Het
Stab2 A T 10: 86,878,926 F125L probably benign Het
Tet2 G T 3: 133,469,519 Q1356K probably benign Het
Tet3 A T 6: 83,386,028 S856T probably damaging Het
Tg C T 15: 66,693,430 T1207I possibly damaging Het
Tkt A G 14: 30,565,568 Y173C probably damaging Het
Tlr6 T A 5: 64,953,411 I718F probably damaging Het
Tnfrsf11b A G 15: 54,254,058 V267A possibly damaging Het
Ubqln3 T A 7: 104,141,546 N446Y probably damaging Het
Vmn2r118 C T 17: 55,608,083 C521Y probably damaging Het
Vps16 A G 2: 130,440,340 D394G probably benign Het
Zfp236 A T 18: 82,674,424 M142K possibly damaging Het
Zfp780b T C 7: 27,964,857 D91G probably benign Het
Zfp97 T A 17: 17,145,206 Y322* probably null Het
Other mutations in Ddx11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01448:Ddx11 APN 17 66134137 missense probably damaging 1.00
IGL01577:Ddx11 APN 17 66139403 missense possibly damaging 0.95
IGL02558:Ddx11 APN 17 66148672 missense probably damaging 0.99
IGL02801:Ddx11 APN 17 66148033 missense probably benign 0.03
R1587:Ddx11 UTSW 17 66149256 missense probably damaging 1.00
R1601:Ddx11 UTSW 17 66150385 missense probably damaging 1.00
R1625:Ddx11 UTSW 17 66150697 missense probably benign 0.45
R1714:Ddx11 UTSW 17 66148759 missense probably damaging 1.00
R1867:Ddx11 UTSW 17 66135939 intron probably null
R1959:Ddx11 UTSW 17 66130728 missense probably benign 0.27
R1980:Ddx11 UTSW 17 66148739 missense probably damaging 0.97
R2392:Ddx11 UTSW 17 66149973 missense probably damaging 1.00
R3118:Ddx11 UTSW 17 66149277 missense probably damaging 1.00
R3425:Ddx11 UTSW 17 66139439 missense possibly damaging 0.62
R3983:Ddx11 UTSW 17 66134130 missense probably damaging 1.00
R4571:Ddx11 UTSW 17 66130773 missense probably benign 0.20
R4576:Ddx11 UTSW 17 66150726 missense probably damaging 1.00
R4847:Ddx11 UTSW 17 66130801 missense probably damaging 1.00
R5010:Ddx11 UTSW 17 66147722 missense possibly damaging 0.60
R5414:Ddx11 UTSW 17 66148768 missense probably benign 0.40
R5610:Ddx11 UTSW 17 66150026 missense probably damaging 1.00
R5822:Ddx11 UTSW 17 66129981 missense probably benign 0.00
R5972:Ddx11 UTSW 17 66148090 missense probably benign 0.05
R6017:Ddx11 UTSW 17 66130017 missense probably benign 0.02
R6267:Ddx11 UTSW 17 66150729 critical splice donor site probably null
R6296:Ddx11 UTSW 17 66150729 critical splice donor site probably null
R7205:Ddx11 UTSW 17 66130771 missense probably benign 0.25
R7531:Ddx11 UTSW 17 66138219 missense probably benign 0.00
R7544:Ddx11 UTSW 17 66126285 missense probably damaging 0.98
R7593:Ddx11 UTSW 17 66126198 missense possibly damaging 0.48
R7778:Ddx11 UTSW 17 66130548 critical splice donor site probably null
R7824:Ddx11 UTSW 17 66130548 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TACTGAACTGCGGCATTCTGGC -3'
(R):5'- TAGTGAGCAGCACCCTGGATGAAG -3'

Sequencing Primer
(F):5'- CCATCCGCAAGGTCTGAGTAAG -3'
(R):5'- CACCCTGGATGAAGCAGAGC -3'
Posted On2014-04-13