Incidental Mutation 'R1551:Slc6a17'
ID 169901
Institutional Source Beutler Lab
Gene Symbol Slc6a17
Ensembl Gene ENSMUSG00000027894
Gene Name solute carrier family 6 (neurotransmitter transporter), member 17
Synonyms NTT4, D130012J15Rik
MMRRC Submission 039590-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.256) question?
Stock # R1551 (G1)
Quality Score 203
Status Not validated
Chromosome 3
Chromosomal Location 107374864-107425334 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 107379443 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 575 (V575A)
Ref Sequence ENSEMBL: ENSMUSP00000129379 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029499] [ENSMUST00000168211] [ENSMUST00000169449]
AlphaFold Q8BJI1
Predicted Effect possibly damaging
Transcript: ENSMUST00000029499
AA Change: V572A

PolyPhen 2 Score 0.846 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000029499
Gene: ENSMUSG00000027894
AA Change: V572A

DomainStartEndE-ValueType
Pfam:SNF 60 640 2.7e-227 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000168211
AA Change: V534A

PolyPhen 2 Score 0.694 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000131888
Gene: ENSMUSG00000027894
AA Change: V534A

DomainStartEndE-ValueType
Pfam:SNF 19 602 1.3e-225 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000169449
AA Change: V575A

PolyPhen 2 Score 0.846 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000129379
Gene: ENSMUSG00000027894
AA Change: V575A

DomainStartEndE-ValueType
Pfam:SNF 60 643 1.1e-225 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171029
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.0%
  • 20x: 83.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SLC6 family of transporters, which are responsible for the presynaptic uptake of most neurotransmitters. The encoded vesicular transporter is selective for proline, glycine, leucine and alanine. Defects in this gene are a cause of autosomal recessive mental retardation-48. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A G 7: 119,918,101 (GRCm39) I1534M probably benign Het
Acad11 G A 9: 104,003,785 (GRCm39) A626T probably damaging Het
Akap9 T A 5: 4,119,174 (GRCm39) N3560K probably benign Het
Aldh3a2 C T 11: 61,144,470 (GRCm39) V363I probably benign Het
Anks1b A G 10: 89,912,843 (GRCm39) T289A probably benign Het
Atp11a A G 8: 12,862,340 (GRCm39) N64S probably damaging Het
Atp11c T C X: 59,282,072 (GRCm39) probably null Het
Cd101 T C 3: 100,919,329 (GRCm39) H591R probably damaging Het
Cd36 C T 5: 18,002,120 (GRCm39) V294I probably benign Het
Cfap47 C A X: 78,532,251 (GRCm39) L842F probably damaging Het
Cgref1 T C 5: 31,090,929 (GRCm39) E295G probably benign Het
Cit A G 5: 116,083,901 (GRCm39) M787V probably benign Het
Clcn6 G A 4: 148,097,235 (GRCm39) P611S possibly damaging Het
Clec12a A C 6: 129,327,384 (GRCm39) M1L probably damaging Het
Cmtm6 C T 9: 114,575,573 (GRCm39) R161W probably damaging Het
Colec10 G T 15: 54,325,658 (GRCm39) V163L probably damaging Het
Coq8b A G 7: 26,956,907 (GRCm39) Y520C probably damaging Het
Ctsll3 C A 13: 60,948,821 (GRCm39) E45* probably null Het
Dsg3 A G 18: 20,669,975 (GRCm39) E663G possibly damaging Het
Dst G A 1: 34,231,293 (GRCm39) R2962H probably benign Het
Etnk2 T C 1: 133,300,995 (GRCm39) I254T probably damaging Het
Fbxo36 T C 1: 84,858,835 (GRCm39) I40T probably damaging Het
Fgd2 G A 17: 29,597,383 (GRCm39) V568M probably damaging Het
Fmn1 T C 2: 113,356,207 (GRCm39) Y883H possibly damaging Het
Fpr-rs4 A T 17: 18,242,589 (GRCm39) T199S possibly damaging Het
Gm12789 A G 4: 101,846,131 (GRCm39) K131E probably benign Het
Gm17641 C A 3: 68,777,448 (GRCm39) silent Het
Gm6665 G T 18: 31,953,340 (GRCm39) R43S probably damaging Het
Gzmc T A 14: 56,470,203 (GRCm39) H98L probably damaging Het
Hecw1 T A 13: 14,491,528 (GRCm39) E75V probably damaging Het
Herc2 G T 7: 55,796,417 (GRCm39) V1930L probably benign Het
Hsh2d G A 8: 72,954,304 (GRCm39) D229N probably benign Het
Htr6 A T 4: 138,801,776 (GRCm39) C99* probably null Het
Lgals2 C T 15: 78,736,511 (GRCm39) M16I probably benign Het
Lrrc8c A G 5: 105,756,090 (GRCm39) N622D probably damaging Het
Myo15a A T 11: 60,383,791 (GRCm39) I1613F possibly damaging Het
Oacyl C T 18: 65,875,280 (GRCm39) R455C probably benign Het
Or13c25 A T 4: 52,911,397 (GRCm39) Y132* probably null Het
Or5ac21 T A 16: 59,123,766 (GRCm39) N84K probably benign Het
Or5bh3 T C X: 49,098,872 (GRCm39) T81A possibly damaging Het
Orm3 A G 4: 63,275,146 (GRCm39) probably null Het
Phf2 G C 13: 48,985,579 (GRCm39) T67S unknown Het
Phf2 A G 13: 48,957,079 (GRCm39) L1096P probably damaging Het
Pigt T C 2: 164,349,323 (GRCm39) V542A probably damaging Het
Pnpla7 T C 2: 24,937,720 (GRCm39) F992L probably benign Het
Ppp2r5e C G 12: 75,516,341 (GRCm39) A239P probably damaging Het
Pramel11 A G 4: 143,622,263 (GRCm39) M364T probably benign Het
Prmt7 A G 8: 106,964,014 (GRCm39) T303A probably benign Het
Prpf4b A T 13: 35,078,426 (GRCm39) I679F possibly damaging Het
Psd4 T A 2: 24,293,292 (GRCm39) M719K probably benign Het
Ranbp9 A T 13: 43,578,593 (GRCm39) M160K probably benign Het
Rfc1 A G 5: 65,434,706 (GRCm39) Y687H probably damaging Het
Rimbp2 T C 5: 128,883,423 (GRCm39) K119R probably damaging Het
Rnf113a1 T C X: 36,455,046 (GRCm39) M1T probably null Het
Rnf40 A C 7: 127,195,506 (GRCm39) K511Q possibly damaging Het
Ryr2 T A 13: 11,800,029 (GRCm39) probably null Het
Scrib A T 15: 75,937,011 (GRCm39) V365E probably damaging Het
Spta1 A G 1: 174,067,732 (GRCm39) N2053S possibly damaging Het
Ssbp2 G A 13: 91,790,511 (GRCm39) probably null Het
Stab1 G T 14: 30,882,456 (GRCm39) N460K probably benign Het
Tbc1d9 T A 8: 83,992,787 (GRCm39) C964S probably benign Het
Tmed11 A G 5: 108,927,680 (GRCm39) probably null Het
Tmem191 C A 16: 17,095,984 (GRCm39) R285S probably damaging Het
Tpr T C 1: 150,312,552 (GRCm39) S1917P probably benign Het
Vill A T 9: 118,892,440 (GRCm39) H357L probably benign Het
Vmn1r229 A G 17: 21,035,051 (GRCm39) T99A probably benign Het
Vmn2r14 A G 5: 109,369,283 (GRCm39) S97P probably damaging Het
Wasf2 G T 4: 132,917,483 (GRCm39) R194L unknown Het
Other mutations in Slc6a17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02432:Slc6a17 APN 3 107,400,493 (GRCm39) missense possibly damaging 0.56
IGL02514:Slc6a17 APN 3 107,402,993 (GRCm39) missense possibly damaging 0.94
IGL03395:Slc6a17 APN 3 107,384,622 (GRCm39) missense probably damaging 1.00
BB002:Slc6a17 UTSW 3 107,403,056 (GRCm39) missense probably damaging 1.00
BB012:Slc6a17 UTSW 3 107,403,056 (GRCm39) missense probably damaging 1.00
R0454:Slc6a17 UTSW 3 107,384,183 (GRCm39) missense probably benign 0.12
R1201:Slc6a17 UTSW 3 107,400,388 (GRCm39) missense possibly damaging 0.90
R1681:Slc6a17 UTSW 3 107,381,702 (GRCm39) missense probably damaging 1.00
R1721:Slc6a17 UTSW 3 107,379,492 (GRCm39) missense probably damaging 1.00
R1765:Slc6a17 UTSW 3 107,380,895 (GRCm39) missense possibly damaging 0.95
R1867:Slc6a17 UTSW 3 107,379,492 (GRCm39) missense probably damaging 1.00
R2167:Slc6a17 UTSW 3 107,398,817 (GRCm39) nonsense probably null
R3708:Slc6a17 UTSW 3 107,400,401 (GRCm39) missense probably benign
R3814:Slc6a17 UTSW 3 107,378,633 (GRCm39) missense possibly damaging 0.92
R4639:Slc6a17 UTSW 3 107,381,597 (GRCm39) missense probably benign
R4807:Slc6a17 UTSW 3 107,407,803 (GRCm39) missense possibly damaging 0.90
R5048:Slc6a17 UTSW 3 107,378,753 (GRCm39) nonsense probably null
R6076:Slc6a17 UTSW 3 107,379,387 (GRCm39) missense possibly damaging 0.67
R6326:Slc6a17 UTSW 3 107,407,722 (GRCm39) missense probably damaging 0.98
R6713:Slc6a17 UTSW 3 107,378,703 (GRCm39) missense probably benign 0.00
R7073:Slc6a17 UTSW 3 107,378,755 (GRCm39) missense probably benign 0.00
R7097:Slc6a17 UTSW 3 107,400,464 (GRCm39) missense probably damaging 1.00
R7323:Slc6a17 UTSW 3 107,398,794 (GRCm39) missense probably benign 0.01
R7597:Slc6a17 UTSW 3 107,378,668 (GRCm39) missense possibly damaging 0.89
R7755:Slc6a17 UTSW 3 107,381,671 (GRCm39) missense probably damaging 1.00
R7841:Slc6a17 UTSW 3 107,384,214 (GRCm39) missense possibly damaging 0.69
R7925:Slc6a17 UTSW 3 107,403,056 (GRCm39) missense probably damaging 1.00
R8041:Slc6a17 UTSW 3 107,381,744 (GRCm39) missense probably damaging 1.00
R8305:Slc6a17 UTSW 3 107,380,901 (GRCm39) missense probably benign 0.31
R8306:Slc6a17 UTSW 3 107,380,985 (GRCm39) missense probably benign
R8488:Slc6a17 UTSW 3 107,384,574 (GRCm39) missense possibly damaging 0.84
R8930:Slc6a17 UTSW 3 107,379,507 (GRCm39) missense probably benign 0.19
R8932:Slc6a17 UTSW 3 107,379,507 (GRCm39) missense probably benign 0.19
R9287:Slc6a17 UTSW 3 107,384,551 (GRCm39) missense probably damaging 1.00
R9483:Slc6a17 UTSW 3 107,378,772 (GRCm39) missense possibly damaging 0.50
R9601:Slc6a17 UTSW 3 107,380,930 (GRCm39) missense possibly damaging 0.95
R9617:Slc6a17 UTSW 3 107,384,685 (GRCm39) missense probably damaging 1.00
X0010:Slc6a17 UTSW 3 107,400,422 (GRCm39) missense probably benign 0.05
X0062:Slc6a17 UTSW 3 107,407,684 (GRCm39) missense probably null 1.00
Z1176:Slc6a17 UTSW 3 107,384,082 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CAAGACCTGTTACAGAGGAGCTGC -3'
(R):5'- CTGGAGATCACAGAACACTGAAGGC -3'

Sequencing Primer
(F):5'- GAGCTGCGCTAGGAAGC -3'
(R):5'- CAGAACACTGAAGGCAAAGGC -3'
Posted On 2014-04-13