Incidental Mutation 'R1551:Abca14'
ID 169924
Institutional Source Beutler Lab
Gene Symbol Abca14
Ensembl Gene ENSMUSG00000062017
Gene Name ATP-binding cassette, sub-family A member 14
Synonyms 1700110B15Rik, 4930539G24Rik
MMRRC Submission 039590-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1551 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 119803184-119924575 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 119918101 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Methionine at position 1534 (I1534M)
Ref Sequence ENSEMBL: ENSMUSP00000081690 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084640]
AlphaFold E9Q8F8
Predicted Effect probably benign
Transcript: ENSMUST00000084640
AA Change: I1534M

PolyPhen 2 Score 0.101 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000081690
Gene: ENSMUSG00000062017
AA Change: I1534M

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 24 463 5.7e-23 PFAM
AAA 548 729 1.59e-10 SMART
Pfam:ABC2_membrane_3 902 1296 1.2e-36 PFAM
AAA 1384 1568 1.33e-3 SMART
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.0%
  • 20x: 83.4%
Validation Efficiency
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad11 G A 9: 104,003,785 (GRCm39) A626T probably damaging Het
Akap9 T A 5: 4,119,174 (GRCm39) N3560K probably benign Het
Aldh3a2 C T 11: 61,144,470 (GRCm39) V363I probably benign Het
Anks1b A G 10: 89,912,843 (GRCm39) T289A probably benign Het
Atp11a A G 8: 12,862,340 (GRCm39) N64S probably damaging Het
Atp11c T C X: 59,282,072 (GRCm39) probably null Het
Cd101 T C 3: 100,919,329 (GRCm39) H591R probably damaging Het
Cd36 C T 5: 18,002,120 (GRCm39) V294I probably benign Het
Cfap47 C A X: 78,532,251 (GRCm39) L842F probably damaging Het
Cgref1 T C 5: 31,090,929 (GRCm39) E295G probably benign Het
Cit A G 5: 116,083,901 (GRCm39) M787V probably benign Het
Clcn6 G A 4: 148,097,235 (GRCm39) P611S possibly damaging Het
Clec12a A C 6: 129,327,384 (GRCm39) M1L probably damaging Het
Cmtm6 C T 9: 114,575,573 (GRCm39) R161W probably damaging Het
Colec10 G T 15: 54,325,658 (GRCm39) V163L probably damaging Het
Coq8b A G 7: 26,956,907 (GRCm39) Y520C probably damaging Het
Ctsll3 C A 13: 60,948,821 (GRCm39) E45* probably null Het
Dsg3 A G 18: 20,669,975 (GRCm39) E663G possibly damaging Het
Dst G A 1: 34,231,293 (GRCm39) R2962H probably benign Het
Etnk2 T C 1: 133,300,995 (GRCm39) I254T probably damaging Het
Fbxo36 T C 1: 84,858,835 (GRCm39) I40T probably damaging Het
Fgd2 G A 17: 29,597,383 (GRCm39) V568M probably damaging Het
Fmn1 T C 2: 113,356,207 (GRCm39) Y883H possibly damaging Het
Fpr-rs4 A T 17: 18,242,589 (GRCm39) T199S possibly damaging Het
Gm12789 A G 4: 101,846,131 (GRCm39) K131E probably benign Het
Gm17641 C A 3: 68,777,448 (GRCm39) silent Het
Gm6665 G T 18: 31,953,340 (GRCm39) R43S probably damaging Het
Gzmc T A 14: 56,470,203 (GRCm39) H98L probably damaging Het
Hecw1 T A 13: 14,491,528 (GRCm39) E75V probably damaging Het
Herc2 G T 7: 55,796,417 (GRCm39) V1930L probably benign Het
Hsh2d G A 8: 72,954,304 (GRCm39) D229N probably benign Het
Htr6 A T 4: 138,801,776 (GRCm39) C99* probably null Het
Lgals2 C T 15: 78,736,511 (GRCm39) M16I probably benign Het
Lrrc8c A G 5: 105,756,090 (GRCm39) N622D probably damaging Het
Myo15a A T 11: 60,383,791 (GRCm39) I1613F possibly damaging Het
Oacyl C T 18: 65,875,280 (GRCm39) R455C probably benign Het
Or13c25 A T 4: 52,911,397 (GRCm39) Y132* probably null Het
Or5ac21 T A 16: 59,123,766 (GRCm39) N84K probably benign Het
Or5bh3 T C X: 49,098,872 (GRCm39) T81A possibly damaging Het
Orm3 A G 4: 63,275,146 (GRCm39) probably null Het
Phf2 G C 13: 48,985,579 (GRCm39) T67S unknown Het
Phf2 A G 13: 48,957,079 (GRCm39) L1096P probably damaging Het
Pigt T C 2: 164,349,323 (GRCm39) V542A probably damaging Het
Pnpla7 T C 2: 24,937,720 (GRCm39) F992L probably benign Het
Ppp2r5e C G 12: 75,516,341 (GRCm39) A239P probably damaging Het
Pramel11 A G 4: 143,622,263 (GRCm39) M364T probably benign Het
Prmt7 A G 8: 106,964,014 (GRCm39) T303A probably benign Het
Prpf4b A T 13: 35,078,426 (GRCm39) I679F possibly damaging Het
Psd4 T A 2: 24,293,292 (GRCm39) M719K probably benign Het
Ranbp9 A T 13: 43,578,593 (GRCm39) M160K probably benign Het
Rfc1 A G 5: 65,434,706 (GRCm39) Y687H probably damaging Het
Rimbp2 T C 5: 128,883,423 (GRCm39) K119R probably damaging Het
Rnf113a1 T C X: 36,455,046 (GRCm39) M1T probably null Het
Rnf40 A C 7: 127,195,506 (GRCm39) K511Q possibly damaging Het
Ryr2 T A 13: 11,800,029 (GRCm39) probably null Het
Scrib A T 15: 75,937,011 (GRCm39) V365E probably damaging Het
Slc6a17 A G 3: 107,379,443 (GRCm39) V575A possibly damaging Het
Spta1 A G 1: 174,067,732 (GRCm39) N2053S possibly damaging Het
Ssbp2 G A 13: 91,790,511 (GRCm39) probably null Het
Stab1 G T 14: 30,882,456 (GRCm39) N460K probably benign Het
Tbc1d9 T A 8: 83,992,787 (GRCm39) C964S probably benign Het
Tmed11 A G 5: 108,927,680 (GRCm39) probably null Het
Tmem191 C A 16: 17,095,984 (GRCm39) R285S probably damaging Het
Tpr T C 1: 150,312,552 (GRCm39) S1917P probably benign Het
Vill A T 9: 118,892,440 (GRCm39) H357L probably benign Het
Vmn1r229 A G 17: 21,035,051 (GRCm39) T99A probably benign Het
Vmn2r14 A G 5: 109,369,283 (GRCm39) S97P probably damaging Het
Wasf2 G T 4: 132,917,483 (GRCm39) R194L unknown Het
Other mutations in Abca14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00486:Abca14 APN 7 119,846,076 (GRCm39) missense probably damaging 1.00
IGL00800:Abca14 APN 7 119,854,613 (GRCm39) missense probably benign 0.01
IGL00845:Abca14 APN 7 119,823,174 (GRCm39) splice site probably benign
IGL00897:Abca14 APN 7 119,815,348 (GRCm39) splice site probably benign
IGL01524:Abca14 APN 7 119,852,644 (GRCm39) missense possibly damaging 0.57
IGL01747:Abca14 APN 7 119,877,310 (GRCm39) missense probably benign 0.00
IGL02214:Abca14 APN 7 119,893,398 (GRCm39) missense probably benign 0.09
IGL02215:Abca14 APN 7 119,852,612 (GRCm39) missense probably benign 0.00
IGL02253:Abca14 APN 7 119,807,182 (GRCm39) missense probably benign 0.29
IGL02302:Abca14 APN 7 119,917,968 (GRCm39) splice site probably benign
IGL03391:Abca14 APN 7 119,846,107 (GRCm39) missense probably damaging 1.00
F6893:Abca14 UTSW 7 119,924,261 (GRCm39) missense probably damaging 0.98
R0109:Abca14 UTSW 7 119,917,985 (GRCm39) nonsense probably null
R0109:Abca14 UTSW 7 119,917,985 (GRCm39) nonsense probably null
R0265:Abca14 UTSW 7 119,822,850 (GRCm39) missense probably benign 0.03
R0326:Abca14 UTSW 7 119,823,642 (GRCm39) missense probably damaging 1.00
R0380:Abca14 UTSW 7 119,877,703 (GRCm39) missense probably benign 0.03
R0418:Abca14 UTSW 7 119,806,657 (GRCm39) missense probably damaging 1.00
R0539:Abca14 UTSW 7 119,807,020 (GRCm39) missense probably damaging 1.00
R0574:Abca14 UTSW 7 119,823,720 (GRCm39) missense probably damaging 0.96
R0611:Abca14 UTSW 7 119,851,479 (GRCm39) missense possibly damaging 0.63
R0783:Abca14 UTSW 7 119,893,380 (GRCm39) missense probably damaging 1.00
R0785:Abca14 UTSW 7 119,893,380 (GRCm39) missense probably damaging 1.00
R0863:Abca14 UTSW 7 119,815,453 (GRCm39) missense probably benign 0.03
R1034:Abca14 UTSW 7 119,815,370 (GRCm39) missense probably damaging 1.00
R1056:Abca14 UTSW 7 119,924,295 (GRCm39) missense probably damaging 1.00
R1072:Abca14 UTSW 7 119,811,992 (GRCm39) missense probably benign
R1244:Abca14 UTSW 7 119,815,561 (GRCm39) missense probably benign 0.06
R1255:Abca14 UTSW 7 119,807,016 (GRCm39) missense probably damaging 0.97
R1271:Abca14 UTSW 7 119,924,340 (GRCm39) missense probably damaging 1.00
R1325:Abca14 UTSW 7 119,846,545 (GRCm39) missense probably benign 0.32
R1457:Abca14 UTSW 7 119,888,683 (GRCm39) missense probably benign 0.00
R1467:Abca14 UTSW 7 119,815,405 (GRCm39) missense possibly damaging 0.80
R1467:Abca14 UTSW 7 119,815,405 (GRCm39) missense possibly damaging 0.80
R1494:Abca14 UTSW 7 119,815,524 (GRCm39) missense probably benign 0.00
R1607:Abca14 UTSW 7 119,850,514 (GRCm39) missense probably damaging 1.00
R1739:Abca14 UTSW 7 119,877,529 (GRCm39) missense probably benign 0.04
R1856:Abca14 UTSW 7 119,877,404 (GRCm39) missense probably damaging 1.00
R1875:Abca14 UTSW 7 119,847,190 (GRCm39) missense possibly damaging 0.78
R1892:Abca14 UTSW 7 119,815,561 (GRCm39) missense probably benign 0.06
R1898:Abca14 UTSW 7 119,850,392 (GRCm39) missense probably damaging 1.00
R1958:Abca14 UTSW 7 119,924,382 (GRCm39) missense probably damaging 0.98
R2018:Abca14 UTSW 7 119,815,408 (GRCm39) missense probably benign 0.00
R2039:Abca14 UTSW 7 119,911,487 (GRCm39) missense probably damaging 0.98
R2060:Abca14 UTSW 7 119,826,741 (GRCm39) nonsense probably null
R2202:Abca14 UTSW 7 119,888,764 (GRCm39) missense probably benign 0.17
R2205:Abca14 UTSW 7 119,846,503 (GRCm39) missense probably damaging 0.98
R2360:Abca14 UTSW 7 119,850,431 (GRCm39) missense probably benign 0.00
R2401:Abca14 UTSW 7 119,882,312 (GRCm39) missense probably damaging 1.00
R2426:Abca14 UTSW 7 119,882,446 (GRCm39) missense probably benign 0.04
R3433:Abca14 UTSW 7 119,893,455 (GRCm39) missense probably damaging 0.97
R4598:Abca14 UTSW 7 119,854,626 (GRCm39) missense probably benign 0.11
R4599:Abca14 UTSW 7 119,854,626 (GRCm39) missense probably benign 0.11
R4700:Abca14 UTSW 7 119,911,928 (GRCm39) critical splice donor site probably null
R4751:Abca14 UTSW 7 119,911,400 (GRCm39) missense probably benign 0.01
R4826:Abca14 UTSW 7 119,815,470 (GRCm39) missense probably damaging 1.00
R4828:Abca14 UTSW 7 119,815,470 (GRCm39) missense probably damaging 1.00
R4837:Abca14 UTSW 7 119,846,203 (GRCm39) missense probably benign
R4881:Abca14 UTSW 7 119,877,472 (GRCm39) missense possibly damaging 0.49
R4895:Abca14 UTSW 7 119,846,572 (GRCm39) critical splice donor site probably null
R4928:Abca14 UTSW 7 119,923,803 (GRCm39) missense possibly damaging 0.90
R4990:Abca14 UTSW 7 119,911,388 (GRCm39) missense probably benign 0.00
R5027:Abca14 UTSW 7 119,911,505 (GRCm39) missense probably benign 0.05
R5091:Abca14 UTSW 7 119,851,497 (GRCm39) missense probably damaging 1.00
R5158:Abca14 UTSW 7 119,852,652 (GRCm39) missense probably benign
R5209:Abca14 UTSW 7 119,832,130 (GRCm39) missense probably benign 0.01
R5333:Abca14 UTSW 7 119,888,769 (GRCm39) nonsense probably null
R5424:Abca14 UTSW 7 119,810,777 (GRCm39) missense probably benign 0.01
R5488:Abca14 UTSW 7 119,851,473 (GRCm39) missense probably damaging 0.98
R5489:Abca14 UTSW 7 119,851,473 (GRCm39) missense probably damaging 0.98
R5716:Abca14 UTSW 7 119,846,217 (GRCm39) critical splice donor site probably null
R6450:Abca14 UTSW 7 119,815,449 (GRCm39) missense probably benign 0.17
R6477:Abca14 UTSW 7 119,924,325 (GRCm39) missense probably benign 0.44
R6652:Abca14 UTSW 7 119,846,164 (GRCm39) missense probably damaging 1.00
R6782:Abca14 UTSW 7 119,847,308 (GRCm39) missense probably damaging 1.00
R6874:Abca14 UTSW 7 119,851,428 (GRCm39) missense possibly damaging 0.71
R6965:Abca14 UTSW 7 119,882,452 (GRCm39) nonsense probably null
R7142:Abca14 UTSW 7 119,850,406 (GRCm39) missense possibly damaging 0.89
R7146:Abca14 UTSW 7 119,854,520 (GRCm39) missense probably benign 0.15
R7202:Abca14 UTSW 7 119,917,236 (GRCm39) missense probably damaging 1.00
R7220:Abca14 UTSW 7 119,826,667 (GRCm39) missense possibly damaging 0.45
R7241:Abca14 UTSW 7 119,846,184 (GRCm39) missense probably damaging 1.00
R7291:Abca14 UTSW 7 119,888,832 (GRCm39) nonsense probably null
R7296:Abca14 UTSW 7 119,877,534 (GRCm39) missense probably benign
R7298:Abca14 UTSW 7 119,807,106 (GRCm39) missense probably benign 0.00
R7315:Abca14 UTSW 7 119,893,341 (GRCm39) missense probably benign 0.00
R7776:Abca14 UTSW 7 119,832,214 (GRCm39) critical splice donor site probably null
R7820:Abca14 UTSW 7 119,811,944 (GRCm39) missense probably benign 0.42
R7873:Abca14 UTSW 7 119,888,792 (GRCm39) missense probably benign 0.17
R8215:Abca14 UTSW 7 119,893,425 (GRCm39) missense probably benign
R8332:Abca14 UTSW 7 119,815,436 (GRCm39) missense probably benign
R8419:Abca14 UTSW 7 119,815,489 (GRCm39) missense probably benign 0.08
R8444:Abca14 UTSW 7 119,918,133 (GRCm39) missense probably damaging 1.00
R8818:Abca14 UTSW 7 119,815,524 (GRCm39) missense probably benign 0.00
R8834:Abca14 UTSW 7 119,877,372 (GRCm39) missense probably benign 0.02
R8845:Abca14 UTSW 7 119,846,428 (GRCm39) missense probably benign 0.00
R8889:Abca14 UTSW 7 119,815,606 (GRCm39) missense probably damaging 1.00
R8892:Abca14 UTSW 7 119,815,606 (GRCm39) missense probably damaging 1.00
R8894:Abca14 UTSW 7 119,847,368 (GRCm39) missense probably damaging 1.00
R8903:Abca14 UTSW 7 119,815,526 (GRCm39) missense probably damaging 0.98
R8950:Abca14 UTSW 7 119,823,595 (GRCm39) missense possibly damaging 0.92
R8950:Abca14 UTSW 7 119,823,644 (GRCm39) nonsense probably null
R9018:Abca14 UTSW 7 119,918,532 (GRCm39) missense probably damaging 0.98
R9018:Abca14 UTSW 7 119,888,763 (GRCm39) missense probably benign 0.01
R9110:Abca14 UTSW 7 119,831,615 (GRCm39) intron probably benign
R9254:Abca14 UTSW 7 119,807,202 (GRCm39) nonsense probably null
R9376:Abca14 UTSW 7 119,893,438 (GRCm39) missense probably damaging 1.00
R9378:Abca14 UTSW 7 119,807,191 (GRCm39) missense possibly damaging 0.64
R9379:Abca14 UTSW 7 119,807,202 (GRCm39) nonsense probably null
R9388:Abca14 UTSW 7 119,882,261 (GRCm39) missense probably benign 0.01
R9445:Abca14 UTSW 7 119,877,691 (GRCm39) missense probably benign 0.05
R9522:Abca14 UTSW 7 119,847,368 (GRCm39) missense probably null 0.98
R9577:Abca14 UTSW 7 119,810,768 (GRCm39) missense probably benign 0.27
R9627:Abca14 UTSW 7 119,854,530 (GRCm39) missense probably benign 0.00
R9639:Abca14 UTSW 7 119,893,345 (GRCm39) missense probably benign 0.01
R9660:Abca14 UTSW 7 119,851,478 (GRCm39) missense probably benign 0.00
R9696:Abca14 UTSW 7 119,888,734 (GRCm39) missense possibly damaging 0.59
R9709:Abca14 UTSW 7 119,888,739 (GRCm39) nonsense probably null
R9780:Abca14 UTSW 7 119,911,447 (GRCm39) missense probably benign 0.00
Z1088:Abca14 UTSW 7 119,815,358 (GRCm39) missense probably benign 0.14
Z1176:Abca14 UTSW 7 119,846,146 (GRCm39) missense probably damaging 1.00
Z1177:Abca14 UTSW 7 119,917,210 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCAGCCCTTTTGAAATCTTGGCAAC -3'
(R):5'- AGCCTGGTACAGAGAGCTTCACAC -3'

Sequencing Primer
(F):5'- ACTGGGTGTGTTACCTGTTAAATTAC -3'
(R):5'- CTTATTATCAGGGCCATAGGGAATG -3'
Posted On 2014-04-13