Incidental Mutation 'R1552:Zranb3'
ID169971
Institutional Source Beutler Lab
Gene Symbol Zranb3
Ensembl Gene ENSMUSG00000036086
Gene Namezinc finger, RAN-binding domain containing 3
Synonyms4933425L19Rik
MMRRC Submission 039591-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.163) question?
Stock #R1552 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location127954184-128103047 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to A at 127960751 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000108157 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086614] [ENSMUST00000112538]
Predicted Effect probably benign
Transcript: ENSMUST00000086614
SMART Domains Protein: ENSMUSP00000083806
Gene: ENSMUSG00000036086

DomainStartEndE-ValueType
DEXDc 33 214 3.37e-19 SMART
HELICc 352 435 3.79e-13 SMART
ZnF_RBZ 619 643 6.93e-5 SMART
HNHc 985 1036 5.64e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112538
SMART Domains Protein: ENSMUSP00000108157
Gene: ENSMUSG00000036086

DomainStartEndE-ValueType
Pfam:SNF2_N 40 98 6.6e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143389
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186230
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.7%
Validation Efficiency 97% (71/73)
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810046K07Rik T A 9: 51,291,570 S95C probably damaging Het
Abcc5 T A 16: 20,398,867 I365F probably damaging Het
Abhd15 T C 11: 77,515,407 L70P probably damaging Het
Adam18 A C 8: 24,646,361 H381Q probably benign Het
Ankfy1 T C 11: 72,754,495 probably null Het
Arcn1 C T 9: 44,758,994 A112T probably damaging Het
Calhm1 C T 19: 47,141,201 R294H probably benign Het
Ccdc121 A G 1: 181,510,991 L132P probably damaging Het
Cdk5rap1 T C 2: 154,370,695 E81G probably benign Het
Cep170 T C 1: 176,782,494 probably benign Het
Cep350 C T 1: 155,910,738 R1454Q possibly damaging Het
Chrna3 C A 9: 55,015,908 E205D probably benign Het
Chst5 T C 8: 111,890,280 D236G probably damaging Het
Coro1a T C 7: 126,699,952 N367D probably benign Het
Cyp3a16 T C 5: 145,436,536 I474V probably benign Het
Cyth3 G A 5: 143,697,750 V87I probably benign Het
Dclk3 C A 9: 111,488,579 T761K probably damaging Het
Dvl2 T A 11: 70,006,372 M300K possibly damaging Het
Eefsec C T 6: 88,376,200 probably benign Het
Exog T C 9: 119,445,110 S54P unknown Het
Fasn A G 11: 120,818,558 S519P probably damaging Het
Gas8 G A 8: 123,520,646 A16T probably benign Het
Got2 A G 8: 95,869,494 S333P probably benign Het
Hadhb T A 5: 30,176,933 L287Q probably null Het
Ift57 A G 16: 49,759,353 T211A probably benign Het
Il1rap A G 16: 26,722,434 E475G possibly damaging Het
Ilkap A T 1: 91,384,594 D11E probably damaging Het
Impact T C 18: 12,984,280 S137P probably benign Het
Jarid2 T C 13: 44,911,199 V920A probably damaging Het
Kcnk18 A T 19: 59,235,458 H345L probably damaging Het
Kdm4d A T 9: 14,464,029 Y178N probably damaging Het
Klk1b1 A G 7: 43,969,343 Y48C probably damaging Het
Klra5 G T 6: 129,909,885 T60K probably damaging Het
Kng2 A T 16: 22,987,520 L643H probably damaging Het
Lamb3 A G 1: 193,330,759 probably null Het
Lingo2 A G 4: 35,708,315 V555A probably damaging Het
Mbd5 T C 2: 49,272,934 S251P probably damaging Het
Mc4r T C 18: 66,859,695 S116G probably benign Het
Mipol1 T C 12: 57,306,088 V71A possibly damaging Het
Myo15b A C 11: 115,866,635 S1104R probably benign Het
Nek1 T A 8: 61,006,737 D26E probably damaging Het
Neu1 C T 17: 34,932,113 probably benign Het
Npffr2 T C 5: 89,583,116 S302P possibly damaging Het
Olfr912 T C 9: 38,581,379 M34T probably benign Het
Palmd T A 3: 116,948,040 probably benign Het
Pcdh8 A T 14: 79,770,607 V172E probably benign Het
Pnpla6 C A 8: 3,522,403 Q291K probably damaging Het
Prkch T C 12: 73,702,546 F357L probably benign Het
Ptprj A T 2: 90,471,153 Y212N probably damaging Het
Reln G T 5: 21,960,378 H2061N probably benign Het
Rint1 T A 5: 23,800,658 S113T probably benign Het
Rnf38 G C 4: 44,142,468 probably null Het
Slc30a4 T A 2: 122,686,016 I374L probably benign Het
Slfn10-ps T C 11: 83,029,850 noncoding transcript Het
Smcp A T 3: 92,584,403 C46S unknown Het
Smu1 A C 4: 40,748,570 V240G probably damaging Het
Srsf5 A G 12: 80,949,745 probably benign Het
Stn1 T C 19: 47,536,373 probably null Het
Stx18 A G 5: 38,104,991 E63G probably damaging Het
Tas2r130 A G 6: 131,630,167 Y222H probably benign Het
Tescl G T 7: 24,333,333 P189Q probably benign Het
Tlr1 A G 5: 64,926,860 S125P probably damaging Het
Ugt2a2 G T 5: 87,462,021 D566E possibly damaging Het
Uhrf1bp1 T C 17: 27,890,071 F1088S possibly damaging Het
Unc13b A T 4: 43,237,144 T3405S probably damaging Het
Upf1 G A 8: 70,333,059 Q1046* probably null Het
Wwox T A 8: 114,445,350 Y61* probably null Het
Zfhx4 C T 3: 5,403,110 T2776M probably damaging Het
Other mutations in Zranb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:Zranb3 APN 1 128016140 missense probably benign 0.01
IGL00818:Zranb3 APN 1 128032867 missense probably damaging 1.00
IGL01360:Zranb3 APN 1 127959885 nonsense probably null
IGL01704:Zranb3 APN 1 127967939 missense possibly damaging 0.93
IGL02131:Zranb3 APN 1 127992951 missense probably damaging 1.00
IGL02466:Zranb3 APN 1 128016092 missense probably benign 0.08
IGL02825:Zranb3 APN 1 127959752 missense probably benign 0.13
IGL02836:Zranb3 APN 1 127960825 missense probably benign 0.00
R0088:Zranb3 UTSW 1 127976462 missense probably benign
R0279:Zranb3 UTSW 1 127963773 missense probably benign 0.01
R0423:Zranb3 UTSW 1 128091870 missense probably damaging 1.00
R0499:Zranb3 UTSW 1 127955080 splice site probably null
R0562:Zranb3 UTSW 1 128036558 missense probably benign 0.04
R0972:Zranb3 UTSW 1 127956646 missense probably damaging 1.00
R1480:Zranb3 UTSW 1 128091862 missense probably damaging 1.00
R1704:Zranb3 UTSW 1 128092003 start codon destroyed probably null 0.22
R1817:Zranb3 UTSW 1 128017556 critical splice donor site probably null
R1818:Zranb3 UTSW 1 128017556 critical splice donor site probably null
R1819:Zranb3 UTSW 1 128017556 critical splice donor site probably null
R1951:Zranb3 UTSW 1 127999399 missense probably damaging 1.00
R1953:Zranb3 UTSW 1 127999399 missense probably damaging 1.00
R1988:Zranb3 UTSW 1 127959743 missense probably benign
R2011:Zranb3 UTSW 1 128091901 missense probably benign 0.00
R3159:Zranb3 UTSW 1 127972949 missense probably benign
R4179:Zranb3 UTSW 1 127960864 missense possibly damaging 0.88
R4281:Zranb3 UTSW 1 127963877 missense possibly damaging 0.69
R4400:Zranb3 UTSW 1 127956655 missense possibly damaging 0.87
R5236:Zranb3 UTSW 1 128040989 missense probably damaging 1.00
R5330:Zranb3 UTSW 1 127959720 missense probably damaging 0.99
R5719:Zranb3 UTSW 1 127963876 missense probably benign 0.00
R6125:Zranb3 UTSW 1 127959745 missense probably benign
R6220:Zranb3 UTSW 1 127999404 missense probably benign 0.44
R6414:Zranb3 UTSW 1 128040957 missense probably benign 0.08
R6751:Zranb3 UTSW 1 127959819 missense probably benign
R7229:Zranb3 UTSW 1 128040893 missense probably benign 0.00
R7419:Zranb3 UTSW 1 127963851 missense possibly damaging 0.86
R7537:Zranb3 UTSW 1 128032847 critical splice donor site probably null
R7771:Zranb3 UTSW 1 128032868 missense probably damaging 1.00
R7980:Zranb3 UTSW 1 128102934 unclassified probably benign
R8152:Zranb3 UTSW 1 127954995 missense probably damaging 1.00
R8370:Zranb3 UTSW 1 127967933 missense probably benign 0.00
R8458:Zranb3 UTSW 1 127992910 missense probably damaging 1.00
R8816:Zranb3 UTSW 1 128036610 missense possibly damaging 0.95
Z1176:Zranb3 UTSW 1 127965148 missense possibly damaging 0.55
Z1176:Zranb3 UTSW 1 128036481 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- CATCTTTAGCCAGGCTGTGGTAGG -3'
(R):5'- ACCAGTAGCCAAATGGAGCATTGTC -3'

Sequencing Primer
(F):5'- TGGTAGGCCAAACAGGCTC -3'
(R):5'- AAATGGAGCATTGTCTGCCTC -3'
Posted On2014-04-13