Incidental Mutation 'R1552:Slc30a4'
ID 169979
Institutional Source Beutler Lab
Gene Symbol Slc30a4
Ensembl Gene ENSMUSG00000005802
Gene Name solute carrier family 30 (zinc transporter), member 4
Synonyms Znt4
MMRRC Submission 039591-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1552 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 122523153-122544583 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 122527936 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Leucine at position 374 (I374L)
Ref Sequence ENSEMBL: ENSMUSP00000005952 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005952] [ENSMUST00000099457]
AlphaFold O35149
Predicted Effect probably benign
Transcript: ENSMUST00000005952
AA Change: I374L

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000005952
Gene: ENSMUSG00000005802
AA Change: I374L

DomainStartEndE-ValueType
low complexity region 67 83 N/A INTRINSIC
Pfam:Cation_efflux 114 333 1.3e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099457
AA Change: I325L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000097056
Gene: ENSMUSG00000005802
AA Change: I325L

DomainStartEndE-ValueType
low complexity region 67 83 N/A INTRINSIC
Pfam:Cation_efflux 124 368 4.6e-46 PFAM
Meta Mutation Damage Score 0.0707 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.7%
Validation Efficiency 97% (71/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Zinc is the second most abundant trace metal in the human body. It is an essential element, serving both a structural role, as in the formation of zinc fingers in DNA-binding proteins, and a catalytic role in metalloenzymes, such as pancreatic carboxypeptidases (e.g., MIM 114852), alkaline phosphatases (e.g., MIM 171760), various dehydrogenases, and superoxide dismutases (e.g., MIM 147450). SLC30A4, or ZNT4, belongs to the ZNT family of zinc transporters. ZNTs are involved in transporting zinc out of the cytoplasm and have similar structures, consisting of 6 transmembrane domains and a histidine-rich cytoplasmic loop (Huang and Gitschier, 1997 [PubMed 9354792]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous mutant dams produce zinc-deficient milk that is lethal to all nursing pups. Pleiotropic defects observed in mutant males and females include otolith degeneration, impaired motor coordination, alopecia, and dermatitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 T A 16: 20,217,617 (GRCm39) I365F probably damaging Het
Abhd15 T C 11: 77,406,233 (GRCm39) L70P probably damaging Het
Adam18 A C 8: 25,136,377 (GRCm39) H381Q probably benign Het
Ankfy1 T C 11: 72,645,321 (GRCm39) probably null Het
Arcn1 C T 9: 44,670,291 (GRCm39) A112T probably damaging Het
Bltp3a T C 17: 28,109,045 (GRCm39) F1088S possibly damaging Het
Calhm1 C T 19: 47,129,640 (GRCm39) R294H probably benign Het
Ccdc121rt1 A G 1: 181,338,556 (GRCm39) L132P probably damaging Het
Cdk5rap1 T C 2: 154,212,615 (GRCm39) E81G probably benign Het
Cep170 T C 1: 176,610,060 (GRCm39) probably benign Het
Cep350 C T 1: 155,786,484 (GRCm39) R1454Q possibly damaging Het
Chrna3 C A 9: 54,923,192 (GRCm39) E205D probably benign Het
Chst5 T C 8: 112,616,912 (GRCm39) D236G probably damaging Het
Coro1a T C 7: 126,299,124 (GRCm39) N367D probably benign Het
Cyp3a16 T C 5: 145,373,346 (GRCm39) I474V probably benign Het
Cyth3 G A 5: 143,683,505 (GRCm39) V87I probably benign Het
Dclk3 C A 9: 111,317,647 (GRCm39) T761K probably damaging Het
Dvl2 T A 11: 69,897,198 (GRCm39) M300K possibly damaging Het
Eefsec C T 6: 88,353,182 (GRCm39) probably benign Het
Exog T C 9: 119,274,176 (GRCm39) S54P unknown Het
Fasn A G 11: 120,709,384 (GRCm39) S519P probably damaging Het
Gas8 G A 8: 124,247,385 (GRCm39) A16T probably benign Het
Got2 A G 8: 96,596,122 (GRCm39) S333P probably benign Het
Hadhb T A 5: 30,381,931 (GRCm39) L287Q probably null Het
Ift57 A G 16: 49,579,716 (GRCm39) T211A probably benign Het
Il1rap A G 16: 26,541,184 (GRCm39) E475G possibly damaging Het
Ilkap A T 1: 91,312,316 (GRCm39) D11E probably damaging Het
Impact T C 18: 13,117,337 (GRCm39) S137P probably benign Het
Jarid2 T C 13: 45,064,675 (GRCm39) V920A probably damaging Het
Kcnk18 A T 19: 59,223,890 (GRCm39) H345L probably damaging Het
Kdm4d A T 9: 14,375,325 (GRCm39) Y178N probably damaging Het
Klk1b1 A G 7: 43,618,767 (GRCm39) Y48C probably damaging Het
Klra5 G T 6: 129,886,848 (GRCm39) T60K probably damaging Het
Kng2 A T 16: 22,806,270 (GRCm39) L643H probably damaging Het
Lamb3 A G 1: 193,013,067 (GRCm39) probably null Het
Lingo2 A G 4: 35,708,315 (GRCm39) V555A probably damaging Het
Mbd5 T C 2: 49,162,946 (GRCm39) S251P probably damaging Het
Mc4r T C 18: 66,992,766 (GRCm39) S116G probably benign Het
Mipol1 T C 12: 57,352,874 (GRCm39) V71A possibly damaging Het
Myo15b A C 11: 115,757,461 (GRCm39) S1104R probably benign Het
Nek1 T A 8: 61,459,771 (GRCm39) D26E probably damaging Het
Neu1 C T 17: 35,151,089 (GRCm39) probably benign Het
Npffr2 T C 5: 89,730,975 (GRCm39) S302P possibly damaging Het
Or8b48 T C 9: 38,492,675 (GRCm39) M34T probably benign Het
Palmd T A 3: 116,741,689 (GRCm39) probably benign Het
Pcdh8 A T 14: 80,008,047 (GRCm39) V172E probably benign Het
Pnpla6 C A 8: 3,572,403 (GRCm39) Q291K probably damaging Het
Pou2af2 T A 9: 51,202,870 (GRCm39) S95C probably damaging Het
Prkch T C 12: 73,749,320 (GRCm39) F357L probably benign Het
Ptprj A T 2: 90,301,497 (GRCm39) Y212N probably damaging Het
Reln G T 5: 22,165,376 (GRCm39) H2061N probably benign Het
Rint1 T A 5: 24,005,656 (GRCm39) S113T probably benign Het
Rnf38 G C 4: 44,142,468 (GRCm39) probably null Het
Slfn10-ps T C 11: 82,920,676 (GRCm39) noncoding transcript Het
Smcp A T 3: 92,491,710 (GRCm39) C46S unknown Het
Smu1 A C 4: 40,748,570 (GRCm39) V240G probably damaging Het
Srsf5 A G 12: 80,996,519 (GRCm39) probably benign Het
Stn1 T C 19: 47,524,812 (GRCm39) probably null Het
Stx18 A G 5: 38,262,335 (GRCm39) E63G probably damaging Het
Tas2r130 A G 6: 131,607,130 (GRCm39) Y222H probably benign Het
Tescl G T 7: 24,032,758 (GRCm39) P189Q probably benign Het
Tlr1 A G 5: 65,084,203 (GRCm39) S125P probably damaging Het
Ugt2a2 G T 5: 87,609,880 (GRCm39) D566E possibly damaging Het
Unc13b A T 4: 43,237,144 (GRCm39) T3405S probably damaging Het
Upf1 G A 8: 70,785,709 (GRCm39) Q1046* probably null Het
Wwox T A 8: 115,172,090 (GRCm39) Y61* probably null Het
Zfhx4 C T 3: 5,468,170 (GRCm39) T2776M probably damaging Het
Zranb3 G A 1: 127,888,488 (GRCm39) probably benign Het
Other mutations in Slc30a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01524:Slc30a4 APN 2 122,544,308 (GRCm39) missense possibly damaging 0.87
IGL01583:Slc30a4 APN 2 122,527,137 (GRCm39) missense probably benign
IGL01823:Slc30a4 APN 2 122,544,012 (GRCm39) missense probably damaging 1.00
IGL02086:Slc30a4 APN 2 122,543,947 (GRCm39) splice site probably benign
F5770:Slc30a4 UTSW 2 122,531,458 (GRCm39) missense probably benign 0.00
R0060:Slc30a4 UTSW 2 122,527,104 (GRCm39) missense probably benign
R0060:Slc30a4 UTSW 2 122,527,104 (GRCm39) missense probably benign
R0373:Slc30a4 UTSW 2 122,531,319 (GRCm39) missense probably damaging 0.99
R0591:Slc30a4 UTSW 2 122,527,160 (GRCm39) missense probably damaging 1.00
R1514:Slc30a4 UTSW 2 122,531,334 (GRCm39) missense probably damaging 1.00
R3847:Slc30a4 UTSW 2 122,544,192 (GRCm39) missense probably damaging 1.00
R4195:Slc30a4 UTSW 2 122,527,190 (GRCm39) missense probably damaging 1.00
R4501:Slc30a4 UTSW 2 122,527,136 (GRCm39) missense probably benign
R5558:Slc30a4 UTSW 2 122,528,903 (GRCm39) missense probably damaging 1.00
R6379:Slc30a4 UTSW 2 122,531,469 (GRCm39) missense probably damaging 1.00
R6393:Slc30a4 UTSW 2 122,527,966 (GRCm39) missense probably damaging 1.00
R7394:Slc30a4 UTSW 2 122,527,224 (GRCm39) missense possibly damaging 0.93
R9464:Slc30a4 UTSW 2 122,527,200 (GRCm39) missense probably damaging 1.00
R9765:Slc30a4 UTSW 2 122,536,456 (GRCm39) missense probably damaging 1.00
V7580:Slc30a4 UTSW 2 122,531,458 (GRCm39) missense probably benign 0.00
V7581:Slc30a4 UTSW 2 122,531,458 (GRCm39) missense probably benign 0.00
V7582:Slc30a4 UTSW 2 122,531,458 (GRCm39) missense probably benign 0.00
V7583:Slc30a4 UTSW 2 122,531,458 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAATTCATCTTTTGAAGAGCCTCCTCCC -3'
(R):5'- ACAGCCAGTGTCATTCCAGCC -3'

Sequencing Primer
(F):5'- CCCTCCCTGAAGTCTTCTTATC -3'
(R):5'- gttcaaggtcagccgatttac -3'
Posted On 2014-04-13