Incidental Mutation 'R1552:Slc30a4'
ID 169979
Institutional Source Beutler Lab
Gene Symbol Slc30a4
Ensembl Gene ENSMUSG00000005802
Gene Name solute carrier family 30 (zinc transporter), member 4
Synonyms Znt4
MMRRC Submission 039591-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R1552 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 122681233-122702663 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 122686016 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Leucine at position 374 (I374L)
Ref Sequence ENSEMBL: ENSMUSP00000005952 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005952] [ENSMUST00000099457]
AlphaFold O35149
Predicted Effect probably benign
Transcript: ENSMUST00000005952
AA Change: I374L

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000005952
Gene: ENSMUSG00000005802
AA Change: I374L

low complexity region 67 83 N/A INTRINSIC
Pfam:Cation_efflux 114 333 1.3e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099457
AA Change: I325L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000097056
Gene: ENSMUSG00000005802
AA Change: I325L

low complexity region 67 83 N/A INTRINSIC
Pfam:Cation_efflux 124 368 4.6e-46 PFAM
Meta Mutation Damage Score 0.0707 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.7%
Validation Efficiency 97% (71/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Zinc is the second most abundant trace metal in the human body. It is an essential element, serving both a structural role, as in the formation of zinc fingers in DNA-binding proteins, and a catalytic role in metalloenzymes, such as pancreatic carboxypeptidases (e.g., MIM 114852), alkaline phosphatases (e.g., MIM 171760), various dehydrogenases, and superoxide dismutases (e.g., MIM 147450). SLC30A4, or ZNT4, belongs to the ZNT family of zinc transporters. ZNTs are involved in transporting zinc out of the cytoplasm and have similar structures, consisting of 6 transmembrane domains and a histidine-rich cytoplasmic loop (Huang and Gitschier, 1997 [PubMed 9354792]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous mutant dams produce zinc-deficient milk that is lethal to all nursing pups. Pleiotropic defects observed in mutant males and females include otolith degeneration, impaired motor coordination, alopecia, and dermatitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810046K07Rik T A 9: 51,291,570 S95C probably damaging Het
Abcc5 T A 16: 20,398,867 I365F probably damaging Het
Abhd15 T C 11: 77,515,407 L70P probably damaging Het
Adam18 A C 8: 24,646,361 H381Q probably benign Het
Ankfy1 T C 11: 72,754,495 probably null Het
Arcn1 C T 9: 44,758,994 A112T probably damaging Het
Calhm1 C T 19: 47,141,201 R294H probably benign Het
Ccdc121 A G 1: 181,510,991 L132P probably damaging Het
Cdk5rap1 T C 2: 154,370,695 E81G probably benign Het
Cep170 T C 1: 176,782,494 probably benign Het
Cep350 C T 1: 155,910,738 R1454Q possibly damaging Het
Chrna3 C A 9: 55,015,908 E205D probably benign Het
Chst5 T C 8: 111,890,280 D236G probably damaging Het
Coro1a T C 7: 126,699,952 N367D probably benign Het
Cyp3a16 T C 5: 145,436,536 I474V probably benign Het
Cyth3 G A 5: 143,697,750 V87I probably benign Het
Dclk3 C A 9: 111,488,579 T761K probably damaging Het
Dvl2 T A 11: 70,006,372 M300K possibly damaging Het
Eefsec C T 6: 88,376,200 probably benign Het
Exog T C 9: 119,445,110 S54P unknown Het
Fasn A G 11: 120,818,558 S519P probably damaging Het
Gas8 G A 8: 123,520,646 A16T probably benign Het
Got2 A G 8: 95,869,494 S333P probably benign Het
Hadhb T A 5: 30,176,933 L287Q probably null Het
Ift57 A G 16: 49,759,353 T211A probably benign Het
Il1rap A G 16: 26,722,434 E475G possibly damaging Het
Ilkap A T 1: 91,384,594 D11E probably damaging Het
Impact T C 18: 12,984,280 S137P probably benign Het
Jarid2 T C 13: 44,911,199 V920A probably damaging Het
Kcnk18 A T 19: 59,235,458 H345L probably damaging Het
Kdm4d A T 9: 14,464,029 Y178N probably damaging Het
Klk1b1 A G 7: 43,969,343 Y48C probably damaging Het
Klra5 G T 6: 129,909,885 T60K probably damaging Het
Kng2 A T 16: 22,987,520 L643H probably damaging Het
Lamb3 A G 1: 193,330,759 probably null Het
Lingo2 A G 4: 35,708,315 V555A probably damaging Het
Mbd5 T C 2: 49,272,934 S251P probably damaging Het
Mc4r T C 18: 66,859,695 S116G probably benign Het
Mipol1 T C 12: 57,306,088 V71A possibly damaging Het
Myo15b A C 11: 115,866,635 S1104R probably benign Het
Nek1 T A 8: 61,006,737 D26E probably damaging Het
Neu1 C T 17: 34,932,113 probably benign Het
Npffr2 T C 5: 89,583,116 S302P possibly damaging Het
Olfr912 T C 9: 38,581,379 M34T probably benign Het
Palmd T A 3: 116,948,040 probably benign Het
Pcdh8 A T 14: 79,770,607 V172E probably benign Het
Pnpla6 C A 8: 3,522,403 Q291K probably damaging Het
Prkch T C 12: 73,702,546 F357L probably benign Het
Ptprj A T 2: 90,471,153 Y212N probably damaging Het
Reln G T 5: 21,960,378 H2061N probably benign Het
Rint1 T A 5: 23,800,658 S113T probably benign Het
Rnf38 G C 4: 44,142,468 probably null Het
Slfn10-ps T C 11: 83,029,850 noncoding transcript Het
Smcp A T 3: 92,584,403 C46S unknown Het
Smu1 A C 4: 40,748,570 V240G probably damaging Het
Srsf5 A G 12: 80,949,745 probably benign Het
Stn1 T C 19: 47,536,373 probably null Het
Stx18 A G 5: 38,104,991 E63G probably damaging Het
Tas2r130 A G 6: 131,630,167 Y222H probably benign Het
Tescl G T 7: 24,333,333 P189Q probably benign Het
Tlr1 A G 5: 64,926,860 S125P probably damaging Het
Ugt2a2 G T 5: 87,462,021 D566E possibly damaging Het
Uhrf1bp1 T C 17: 27,890,071 F1088S possibly damaging Het
Unc13b A T 4: 43,237,144 T3405S probably damaging Het
Upf1 G A 8: 70,333,059 Q1046* probably null Het
Wwox T A 8: 114,445,350 Y61* probably null Het
Zfhx4 C T 3: 5,403,110 T2776M probably damaging Het
Zranb3 G A 1: 127,960,751 probably benign Het
Other mutations in Slc30a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01524:Slc30a4 APN 2 122702388 missense possibly damaging 0.87
IGL01583:Slc30a4 APN 2 122685217 missense probably benign
IGL01823:Slc30a4 APN 2 122702092 missense probably damaging 1.00
IGL02086:Slc30a4 APN 2 122702027 splice site probably benign
F5770:Slc30a4 UTSW 2 122689538 missense probably benign 0.00
R0060:Slc30a4 UTSW 2 122685184 missense probably benign
R0060:Slc30a4 UTSW 2 122685184 missense probably benign
R0373:Slc30a4 UTSW 2 122689399 missense probably damaging 0.99
R0591:Slc30a4 UTSW 2 122685240 missense probably damaging 1.00
R1514:Slc30a4 UTSW 2 122689414 missense probably damaging 1.00
R3847:Slc30a4 UTSW 2 122702272 missense probably damaging 1.00
R4195:Slc30a4 UTSW 2 122685270 missense probably damaging 1.00
R4501:Slc30a4 UTSW 2 122685216 missense probably benign
R5558:Slc30a4 UTSW 2 122686983 missense probably damaging 1.00
R6379:Slc30a4 UTSW 2 122689549 missense probably damaging 1.00
R6393:Slc30a4 UTSW 2 122686046 missense probably damaging 1.00
R7394:Slc30a4 UTSW 2 122685304 missense possibly damaging 0.93
R9464:Slc30a4 UTSW 2 122685280 missense probably damaging 1.00
V7580:Slc30a4 UTSW 2 122689538 missense probably benign 0.00
V7581:Slc30a4 UTSW 2 122689538 missense probably benign 0.00
V7582:Slc30a4 UTSW 2 122689538 missense probably benign 0.00
V7583:Slc30a4 UTSW 2 122689538 missense probably benign 0.00
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- gttcaaggtcagccgatttac -3'
Posted On 2014-04-13