Incidental Mutation 'R1552:Smu1'
ID169988
Institutional Source Beutler Lab
Gene Symbol Smu1
Ensembl Gene ENSMUSG00000028409
Gene Namesmu-1 suppressor of mec-8 and unc-52 homolog (C. elegans)
Synonyms2610203K23Rik, 2600001O03Rik, SMU-1
MMRRC Submission 039591-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock #R1552 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location40736542-40757923 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 40748570 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 240 (V240G)
Ref Sequence ENSEMBL: ENSMUSP00000030117 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030117]
Predicted Effect probably damaging
Transcript: ENSMUST00000030117
AA Change: V240G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000030117
Gene: ENSMUSG00000028409
AA Change: V240G

DomainStartEndE-ValueType
LisH 6 38 9.95e-7 SMART
CTLH 40 92 2.32e-7 SMART
WD40 202 242 9.02e-7 SMART
WD40 253 292 3.81e-5 SMART
WD40 295 335 5.26e-8 SMART
WD40 338 377 4.4e-10 SMART
WD40 380 426 1.03e1 SMART
WD40 428 470 2.97e0 SMART
WD40 473 512 9.52e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130503
Meta Mutation Damage Score 0.9247 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.7%
Validation Efficiency 97% (71/73)
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810046K07Rik T A 9: 51,291,570 S95C probably damaging Het
Abcc5 T A 16: 20,398,867 I365F probably damaging Het
Abhd15 T C 11: 77,515,407 L70P probably damaging Het
Adam18 A C 8: 24,646,361 H381Q probably benign Het
Ankfy1 T C 11: 72,754,495 probably null Het
Arcn1 C T 9: 44,758,994 A112T probably damaging Het
Calhm1 C T 19: 47,141,201 R294H probably benign Het
Ccdc121 A G 1: 181,510,991 L132P probably damaging Het
Cdk5rap1 T C 2: 154,370,695 E81G probably benign Het
Cep170 T C 1: 176,782,494 probably benign Het
Cep350 C T 1: 155,910,738 R1454Q possibly damaging Het
Chrna3 C A 9: 55,015,908 E205D probably benign Het
Chst5 T C 8: 111,890,280 D236G probably damaging Het
Coro1a T C 7: 126,699,952 N367D probably benign Het
Cyp3a16 T C 5: 145,436,536 I474V probably benign Het
Cyth3 G A 5: 143,697,750 V87I probably benign Het
Dclk3 C A 9: 111,488,579 T761K probably damaging Het
Dvl2 T A 11: 70,006,372 M300K possibly damaging Het
Eefsec C T 6: 88,376,200 probably benign Het
Exog T C 9: 119,445,110 S54P unknown Het
Fasn A G 11: 120,818,558 S519P probably damaging Het
Gas8 G A 8: 123,520,646 A16T probably benign Het
Got2 A G 8: 95,869,494 S333P probably benign Het
Hadhb T A 5: 30,176,933 L287Q probably null Het
Ift57 A G 16: 49,759,353 T211A probably benign Het
Il1rap A G 16: 26,722,434 E475G possibly damaging Het
Ilkap A T 1: 91,384,594 D11E probably damaging Het
Impact T C 18: 12,984,280 S137P probably benign Het
Jarid2 T C 13: 44,911,199 V920A probably damaging Het
Kcnk18 A T 19: 59,235,458 H345L probably damaging Het
Kdm4d A T 9: 14,464,029 Y178N probably damaging Het
Klk1b1 A G 7: 43,969,343 Y48C probably damaging Het
Klra5 G T 6: 129,909,885 T60K probably damaging Het
Kng2 A T 16: 22,987,520 L643H probably damaging Het
Lamb3 A G 1: 193,330,759 probably null Het
Lingo2 A G 4: 35,708,315 V555A probably damaging Het
Mbd5 T C 2: 49,272,934 S251P probably damaging Het
Mc4r T C 18: 66,859,695 S116G probably benign Het
Mipol1 T C 12: 57,306,088 V71A possibly damaging Het
Myo15b A C 11: 115,866,635 S1104R probably benign Het
Nek1 T A 8: 61,006,737 D26E probably damaging Het
Neu1 C T 17: 34,932,113 probably benign Het
Npffr2 T C 5: 89,583,116 S302P possibly damaging Het
Olfr912 T C 9: 38,581,379 M34T probably benign Het
Palmd T A 3: 116,948,040 probably benign Het
Pcdh8 A T 14: 79,770,607 V172E probably benign Het
Pnpla6 C A 8: 3,522,403 Q291K probably damaging Het
Prkch T C 12: 73,702,546 F357L probably benign Het
Ptprj A T 2: 90,471,153 Y212N probably damaging Het
Reln G T 5: 21,960,378 H2061N probably benign Het
Rint1 T A 5: 23,800,658 S113T probably benign Het
Rnf38 G C 4: 44,142,468 probably null Het
Slc30a4 T A 2: 122,686,016 I374L probably benign Het
Slfn10-ps T C 11: 83,029,850 noncoding transcript Het
Smcp A T 3: 92,584,403 C46S unknown Het
Srsf5 A G 12: 80,949,745 probably benign Het
Stn1 T C 19: 47,536,373 probably null Het
Stx18 A G 5: 38,104,991 E63G probably damaging Het
Tas2r130 A G 6: 131,630,167 Y222H probably benign Het
Tescl G T 7: 24,333,333 P189Q probably benign Het
Tlr1 A G 5: 64,926,860 S125P probably damaging Het
Ugt2a2 G T 5: 87,462,021 D566E possibly damaging Het
Uhrf1bp1 T C 17: 27,890,071 F1088S possibly damaging Het
Unc13b A T 4: 43,237,144 T3405S probably damaging Het
Upf1 G A 8: 70,333,059 Q1046* probably null Het
Wwox T A 8: 114,445,350 Y61* probably null Het
Zfhx4 C T 3: 5,403,110 T2776M probably damaging Het
Zranb3 G A 1: 127,960,751 probably benign Het
Other mutations in Smu1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02992:Smu1 APN 4 40739550 missense probably damaging 0.97
IGL03271:Smu1 APN 4 40738408 missense probably benign 0.11
IGL03329:Smu1 APN 4 40739568 missense possibly damaging 0.81
PIT4585001:Smu1 UTSW 4 40739623 missense probably benign
R0172:Smu1 UTSW 4 40738439 missense probably benign 0.00
R1109:Smu1 UTSW 4 40755722 missense probably benign 0.12
R1799:Smu1 UTSW 4 40745537 missense probably damaging 1.00
R2093:Smu1 UTSW 4 40738438 missense probably benign 0.12
R2143:Smu1 UTSW 4 40744073 missense probably damaging 0.99
R3082:Smu1 UTSW 4 40745567 missense probably damaging 1.00
R3083:Smu1 UTSW 4 40745567 missense probably damaging 1.00
R3113:Smu1 UTSW 4 40748658 missense probably benign 0.03
R3157:Smu1 UTSW 4 40754529 missense possibly damaging 0.82
R3158:Smu1 UTSW 4 40754529 missense possibly damaging 0.82
R3159:Smu1 UTSW 4 40754529 missense possibly damaging 0.82
R3409:Smu1 UTSW 4 40752008 missense probably benign
R3411:Smu1 UTSW 4 40752008 missense probably benign
R4581:Smu1 UTSW 4 40737401 splice site probably null
R5106:Smu1 UTSW 4 40743104 missense possibly damaging 0.82
R7747:Smu1 UTSW 4 40748600 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- CCTTAGGACACTTTCTCGACTCTAGATAGACA -3'
(R):5'- CACCCACCAGGGTCAGGTATAAACA -3'

Sequencing Primer
(F):5'- aaagggggagtgggtgg -3'
(R):5'- tctgactccctcttctggtg -3'
Posted On2014-04-13