Incidental Mutation 'R1552:Rint1'
ID 169992
Institutional Source Beutler Lab
Gene Symbol Rint1
Ensembl Gene ENSMUSG00000028999
Gene Name RAD50 interactor 1
Synonyms 1500019C06Rik, 2810450M21Rik
MMRRC Submission 039591-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1552 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 23992709-24025367 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 24005656 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 113 (S113T)
Ref Sequence ENSEMBL: ENSMUSP00000110766 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030852] [ENSMUST00000115113]
AlphaFold Q8BZ36
Predicted Effect probably benign
Transcript: ENSMUST00000030852
AA Change: S113T

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000030852
Gene: ENSMUSG00000028999
AA Change: S113T

DomainStartEndE-ValueType
Pfam:RINT1_TIP1 304 784 2.3e-135 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000112256
Predicted Effect probably benign
Transcript: ENSMUST00000115113
AA Change: S113T

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000110766
Gene: ENSMUSG00000028999
AA Change: S113T

DomainStartEndE-ValueType
Pfam:RINT1_TIP1 246 727 1.2e-161 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124680
Meta Mutation Damage Score 0.0750 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.7%
Validation Efficiency 97% (71/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein first identified for its ability to interact with the RAD50 double strand break repair protein, with the resulting interaction implicated in the regulation of cell cycle progression and telomere length. The encoded protein may also play a role in trafficking of cellular cargo from the endosome to the trans-Golgi network. Mutations in this gene may be associated with breast cancer in human patients. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a mutant allele exhibit early embryonic lethality. Mice heterozygous for a mutant allele exhibit premature death with a life span of 24 months and increased multiple tumor incidence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 T A 16: 20,217,617 (GRCm39) I365F probably damaging Het
Abhd15 T C 11: 77,406,233 (GRCm39) L70P probably damaging Het
Adam18 A C 8: 25,136,377 (GRCm39) H381Q probably benign Het
Ankfy1 T C 11: 72,645,321 (GRCm39) probably null Het
Arcn1 C T 9: 44,670,291 (GRCm39) A112T probably damaging Het
Bltp3a T C 17: 28,109,045 (GRCm39) F1088S possibly damaging Het
Calhm1 C T 19: 47,129,640 (GRCm39) R294H probably benign Het
Ccdc121rt1 A G 1: 181,338,556 (GRCm39) L132P probably damaging Het
Cdk5rap1 T C 2: 154,212,615 (GRCm39) E81G probably benign Het
Cep170 T C 1: 176,610,060 (GRCm39) probably benign Het
Cep350 C T 1: 155,786,484 (GRCm39) R1454Q possibly damaging Het
Chrna3 C A 9: 54,923,192 (GRCm39) E205D probably benign Het
Chst5 T C 8: 112,616,912 (GRCm39) D236G probably damaging Het
Coro1a T C 7: 126,299,124 (GRCm39) N367D probably benign Het
Cyp3a16 T C 5: 145,373,346 (GRCm39) I474V probably benign Het
Cyth3 G A 5: 143,683,505 (GRCm39) V87I probably benign Het
Dclk3 C A 9: 111,317,647 (GRCm39) T761K probably damaging Het
Dvl2 T A 11: 69,897,198 (GRCm39) M300K possibly damaging Het
Eefsec C T 6: 88,353,182 (GRCm39) probably benign Het
Exog T C 9: 119,274,176 (GRCm39) S54P unknown Het
Fasn A G 11: 120,709,384 (GRCm39) S519P probably damaging Het
Gas8 G A 8: 124,247,385 (GRCm39) A16T probably benign Het
Got2 A G 8: 96,596,122 (GRCm39) S333P probably benign Het
Hadhb T A 5: 30,381,931 (GRCm39) L287Q probably null Het
Ift57 A G 16: 49,579,716 (GRCm39) T211A probably benign Het
Il1rap A G 16: 26,541,184 (GRCm39) E475G possibly damaging Het
Ilkap A T 1: 91,312,316 (GRCm39) D11E probably damaging Het
Impact T C 18: 13,117,337 (GRCm39) S137P probably benign Het
Jarid2 T C 13: 45,064,675 (GRCm39) V920A probably damaging Het
Kcnk18 A T 19: 59,223,890 (GRCm39) H345L probably damaging Het
Kdm4d A T 9: 14,375,325 (GRCm39) Y178N probably damaging Het
Klk1b1 A G 7: 43,618,767 (GRCm39) Y48C probably damaging Het
Klra5 G T 6: 129,886,848 (GRCm39) T60K probably damaging Het
Kng2 A T 16: 22,806,270 (GRCm39) L643H probably damaging Het
Lamb3 A G 1: 193,013,067 (GRCm39) probably null Het
Lingo2 A G 4: 35,708,315 (GRCm39) V555A probably damaging Het
Mbd5 T C 2: 49,162,946 (GRCm39) S251P probably damaging Het
Mc4r T C 18: 66,992,766 (GRCm39) S116G probably benign Het
Mipol1 T C 12: 57,352,874 (GRCm39) V71A possibly damaging Het
Myo15b A C 11: 115,757,461 (GRCm39) S1104R probably benign Het
Nek1 T A 8: 61,459,771 (GRCm39) D26E probably damaging Het
Neu1 C T 17: 35,151,089 (GRCm39) probably benign Het
Npffr2 T C 5: 89,730,975 (GRCm39) S302P possibly damaging Het
Or8b48 T C 9: 38,492,675 (GRCm39) M34T probably benign Het
Palmd T A 3: 116,741,689 (GRCm39) probably benign Het
Pcdh8 A T 14: 80,008,047 (GRCm39) V172E probably benign Het
Pnpla6 C A 8: 3,572,403 (GRCm39) Q291K probably damaging Het
Pou2af2 T A 9: 51,202,870 (GRCm39) S95C probably damaging Het
Prkch T C 12: 73,749,320 (GRCm39) F357L probably benign Het
Ptprj A T 2: 90,301,497 (GRCm39) Y212N probably damaging Het
Reln G T 5: 22,165,376 (GRCm39) H2061N probably benign Het
Rnf38 G C 4: 44,142,468 (GRCm39) probably null Het
Slc30a4 T A 2: 122,527,936 (GRCm39) I374L probably benign Het
Slfn10-ps T C 11: 82,920,676 (GRCm39) noncoding transcript Het
Smcp A T 3: 92,491,710 (GRCm39) C46S unknown Het
Smu1 A C 4: 40,748,570 (GRCm39) V240G probably damaging Het
Srsf5 A G 12: 80,996,519 (GRCm39) probably benign Het
Stn1 T C 19: 47,524,812 (GRCm39) probably null Het
Stx18 A G 5: 38,262,335 (GRCm39) E63G probably damaging Het
Tas2r130 A G 6: 131,607,130 (GRCm39) Y222H probably benign Het
Tescl G T 7: 24,032,758 (GRCm39) P189Q probably benign Het
Tlr1 A G 5: 65,084,203 (GRCm39) S125P probably damaging Het
Ugt2a2 G T 5: 87,609,880 (GRCm39) D566E possibly damaging Het
Unc13b A T 4: 43,237,144 (GRCm39) T3405S probably damaging Het
Upf1 G A 8: 70,785,709 (GRCm39) Q1046* probably null Het
Wwox T A 8: 115,172,090 (GRCm39) Y61* probably null Het
Zfhx4 C T 3: 5,468,170 (GRCm39) T2776M probably damaging Het
Zranb3 G A 1: 127,888,488 (GRCm39) probably benign Het
Other mutations in Rint1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Rint1 APN 5 23,999,429 (GRCm39) missense probably benign 0.00
IGL00596:Rint1 APN 5 24,016,863 (GRCm39) missense probably damaging 0.99
IGL01685:Rint1 APN 5 23,992,832 (GRCm39) unclassified probably benign
IGL02428:Rint1 APN 5 23,999,450 (GRCm39) nonsense probably null
IGL03007:Rint1 APN 5 24,020,699 (GRCm39) missense probably benign 0.00
IGL03280:Rint1 APN 5 24,022,076 (GRCm39) missense probably damaging 1.00
breakage UTSW 5 24,005,720 (GRCm39) missense probably damaging 0.99
IGL02799:Rint1 UTSW 5 24,024,478 (GRCm39) missense possibly damaging 0.93
R0062:Rint1 UTSW 5 23,992,826 (GRCm39) unclassified probably benign
R0243:Rint1 UTSW 5 24,021,930 (GRCm39) splice site probably benign
R1102:Rint1 UTSW 5 24,010,565 (GRCm39) splice site probably benign
R1729:Rint1 UTSW 5 24,014,841 (GRCm39) missense probably benign 0.00
R1784:Rint1 UTSW 5 24,014,841 (GRCm39) missense probably benign 0.00
R2070:Rint1 UTSW 5 24,015,927 (GRCm39) missense possibly damaging 0.94
R2920:Rint1 UTSW 5 24,010,400 (GRCm39) missense probably benign 0.00
R3114:Rint1 UTSW 5 24,024,418 (GRCm39) missense probably benign 0.27
R4398:Rint1 UTSW 5 23,999,445 (GRCm39) missense possibly damaging 0.55
R4756:Rint1 UTSW 5 24,014,791 (GRCm39) missense probably damaging 1.00
R5246:Rint1 UTSW 5 24,005,809 (GRCm39) missense probably damaging 0.99
R5452:Rint1 UTSW 5 23,999,363 (GRCm39) missense probably benign 0.01
R5566:Rint1 UTSW 5 24,015,951 (GRCm39) missense probably damaging 1.00
R5709:Rint1 UTSW 5 24,020,831 (GRCm39) missense probably damaging 0.98
R6524:Rint1 UTSW 5 24,020,737 (GRCm39) missense probably benign 0.00
R7346:Rint1 UTSW 5 24,020,651 (GRCm39) missense possibly damaging 0.82
R7549:Rint1 UTSW 5 24,020,702 (GRCm39) missense probably benign
R7634:Rint1 UTSW 5 24,010,477 (GRCm39) missense probably benign 0.00
R7647:Rint1 UTSW 5 24,005,800 (GRCm39) missense probably damaging 1.00
R7885:Rint1 UTSW 5 24,010,642 (GRCm39) missense probably benign
R7895:Rint1 UTSW 5 24,005,720 (GRCm39) missense probably damaging 0.99
R8347:Rint1 UTSW 5 24,016,770 (GRCm39) missense probably damaging 1.00
R8791:Rint1 UTSW 5 24,005,594 (GRCm39) missense probably damaging 0.99
R8900:Rint1 UTSW 5 24,016,882 (GRCm39) missense possibly damaging 0.77
R8916:Rint1 UTSW 5 23,992,826 (GRCm39) unclassified probably benign
R8973:Rint1 UTSW 5 24,016,728 (GRCm39) missense probably benign 0.00
R9245:Rint1 UTSW 5 24,010,411 (GRCm39) missense probably benign
R9339:Rint1 UTSW 5 23,993,355 (GRCm39) makesense probably null
R9630:Rint1 UTSW 5 24,020,810 (GRCm39) missense possibly damaging 0.82
R9718:Rint1 UTSW 5 24,005,721 (GRCm39) missense possibly damaging 0.53
Z1088:Rint1 UTSW 5 24,010,312 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGAAAACTTTGAGTTCTGTTGGAACGTG -3'
(R):5'- GTGTTCAAAATGCAACTGCTTAGCCT -3'

Sequencing Primer
(F):5'- GGAACGTGTTTTTGGAAAAGTC -3'
(R):5'- cagagggctatacagggaaac -3'
Posted On 2014-04-13