Incidental Mutation 'R1552:Rint1'
ID169992
Institutional Source Beutler Lab
Gene Symbol Rint1
Ensembl Gene ENSMUSG00000028999
Gene NameRAD50 interactor 1
Synonyms2810450M21Rik, 1500019C06Rik
MMRRC Submission 039591-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1552 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location23787711-23820369 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 23800658 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 113 (S113T)
Ref Sequence ENSEMBL: ENSMUSP00000110766 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030852] [ENSMUST00000115113]
Predicted Effect probably benign
Transcript: ENSMUST00000030852
AA Change: S113T

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000030852
Gene: ENSMUSG00000028999
AA Change: S113T

DomainStartEndE-ValueType
Pfam:RINT1_TIP1 304 784 2.3e-135 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000112256
Predicted Effect probably benign
Transcript: ENSMUST00000115113
AA Change: S113T

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000110766
Gene: ENSMUSG00000028999
AA Change: S113T

DomainStartEndE-ValueType
Pfam:RINT1_TIP1 246 727 1.2e-161 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124680
Meta Mutation Damage Score 0.0750 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.7%
Validation Efficiency 97% (71/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein first identified for its ability to interact with the RAD50 double strand break repair protein, with the resulting interaction implicated in the regulation of cell cycle progression and telomere length. The encoded protein may also play a role in trafficking of cellular cargo from the endosome to the trans-Golgi network. Mutations in this gene may be associated with breast cancer in human patients. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a mutant allele exhibit early embryonic lethality. Mice heterozygous for a mutant allele exhibit premature death with a life span of 24 months and increased multiple tumor incidence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810046K07Rik T A 9: 51,291,570 S95C probably damaging Het
Abcc5 T A 16: 20,398,867 I365F probably damaging Het
Abhd15 T C 11: 77,515,407 L70P probably damaging Het
Adam18 A C 8: 24,646,361 H381Q probably benign Het
Ankfy1 T C 11: 72,754,495 probably null Het
Arcn1 C T 9: 44,758,994 A112T probably damaging Het
Calhm1 C T 19: 47,141,201 R294H probably benign Het
Ccdc121 A G 1: 181,510,991 L132P probably damaging Het
Cdk5rap1 T C 2: 154,370,695 E81G probably benign Het
Cep170 T C 1: 176,782,494 probably benign Het
Cep350 C T 1: 155,910,738 R1454Q possibly damaging Het
Chrna3 C A 9: 55,015,908 E205D probably benign Het
Chst5 T C 8: 111,890,280 D236G probably damaging Het
Coro1a T C 7: 126,699,952 N367D probably benign Het
Cyp3a16 T C 5: 145,436,536 I474V probably benign Het
Cyth3 G A 5: 143,697,750 V87I probably benign Het
Dclk3 C A 9: 111,488,579 T761K probably damaging Het
Dvl2 T A 11: 70,006,372 M300K possibly damaging Het
Eefsec C T 6: 88,376,200 probably benign Het
Exog T C 9: 119,445,110 S54P unknown Het
Fasn A G 11: 120,818,558 S519P probably damaging Het
Gas8 G A 8: 123,520,646 A16T probably benign Het
Got2 A G 8: 95,869,494 S333P probably benign Het
Hadhb T A 5: 30,176,933 L287Q probably null Het
Ift57 A G 16: 49,759,353 T211A probably benign Het
Il1rap A G 16: 26,722,434 E475G possibly damaging Het
Ilkap A T 1: 91,384,594 D11E probably damaging Het
Impact T C 18: 12,984,280 S137P probably benign Het
Jarid2 T C 13: 44,911,199 V920A probably damaging Het
Kcnk18 A T 19: 59,235,458 H345L probably damaging Het
Kdm4d A T 9: 14,464,029 Y178N probably damaging Het
Klk1b1 A G 7: 43,969,343 Y48C probably damaging Het
Klra5 G T 6: 129,909,885 T60K probably damaging Het
Kng2 A T 16: 22,987,520 L643H probably damaging Het
Lamb3 A G 1: 193,330,759 probably null Het
Lingo2 A G 4: 35,708,315 V555A probably damaging Het
Mbd5 T C 2: 49,272,934 S251P probably damaging Het
Mc4r T C 18: 66,859,695 S116G probably benign Het
Mipol1 T C 12: 57,306,088 V71A possibly damaging Het
Myo15b A C 11: 115,866,635 S1104R probably benign Het
Nek1 T A 8: 61,006,737 D26E probably damaging Het
Neu1 C T 17: 34,932,113 probably benign Het
Npffr2 T C 5: 89,583,116 S302P possibly damaging Het
Olfr912 T C 9: 38,581,379 M34T probably benign Het
Palmd T A 3: 116,948,040 probably benign Het
Pcdh8 A T 14: 79,770,607 V172E probably benign Het
Pnpla6 C A 8: 3,522,403 Q291K probably damaging Het
Prkch T C 12: 73,702,546 F357L probably benign Het
Ptprj A T 2: 90,471,153 Y212N probably damaging Het
Reln G T 5: 21,960,378 H2061N probably benign Het
Rnf38 G C 4: 44,142,468 probably null Het
Slc30a4 T A 2: 122,686,016 I374L probably benign Het
Slfn10-ps T C 11: 83,029,850 noncoding transcript Het
Smcp A T 3: 92,584,403 C46S unknown Het
Smu1 A C 4: 40,748,570 V240G probably damaging Het
Srsf5 A G 12: 80,949,745 probably benign Het
Stn1 T C 19: 47,536,373 probably null Het
Stx18 A G 5: 38,104,991 E63G probably damaging Het
Tas2r130 A G 6: 131,630,167 Y222H probably benign Het
Tescl G T 7: 24,333,333 P189Q probably benign Het
Tlr1 A G 5: 64,926,860 S125P probably damaging Het
Ugt2a2 G T 5: 87,462,021 D566E possibly damaging Het
Uhrf1bp1 T C 17: 27,890,071 F1088S possibly damaging Het
Unc13b A T 4: 43,237,144 T3405S probably damaging Het
Upf1 G A 8: 70,333,059 Q1046* probably null Het
Wwox T A 8: 114,445,350 Y61* probably null Het
Zfhx4 C T 3: 5,403,110 T2776M probably damaging Het
Zranb3 G A 1: 127,960,751 probably benign Het
Other mutations in Rint1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Rint1 APN 5 23794431 missense probably benign 0.00
IGL00596:Rint1 APN 5 23811865 missense probably damaging 0.99
IGL01685:Rint1 APN 5 23787834 unclassified probably benign
IGL02428:Rint1 APN 5 23794452 nonsense probably null
IGL03007:Rint1 APN 5 23815701 missense probably benign 0.00
IGL03280:Rint1 APN 5 23817078 missense probably damaging 1.00
breakage UTSW 5 23800722 missense probably damaging 0.99
IGL02799:Rint1 UTSW 5 23819480 missense possibly damaging 0.93
R0062:Rint1 UTSW 5 23787828 unclassified probably benign
R0243:Rint1 UTSW 5 23816932 splice site probably benign
R1102:Rint1 UTSW 5 23805567 splice site probably benign
R1729:Rint1 UTSW 5 23809843 missense probably benign 0.00
R1784:Rint1 UTSW 5 23809843 missense probably benign 0.00
R2070:Rint1 UTSW 5 23810929 missense possibly damaging 0.94
R2920:Rint1 UTSW 5 23805402 missense probably benign 0.00
R3114:Rint1 UTSW 5 23819420 missense probably benign 0.27
R4398:Rint1 UTSW 5 23794447 missense possibly damaging 0.55
R4756:Rint1 UTSW 5 23809793 missense probably damaging 1.00
R5246:Rint1 UTSW 5 23800811 missense probably damaging 0.99
R5452:Rint1 UTSW 5 23794365 missense probably benign 0.01
R5566:Rint1 UTSW 5 23810953 missense probably damaging 1.00
R5709:Rint1 UTSW 5 23815833 missense probably damaging 0.98
R6524:Rint1 UTSW 5 23815739 missense probably benign 0.00
R7346:Rint1 UTSW 5 23815653 missense possibly damaging 0.82
R7549:Rint1 UTSW 5 23815704 missense probably benign
R7634:Rint1 UTSW 5 23805479 missense probably benign 0.00
R7647:Rint1 UTSW 5 23800802 missense probably damaging 1.00
R7885:Rint1 UTSW 5 23805644 missense probably benign
R7895:Rint1 UTSW 5 23800722 missense probably damaging 0.99
R8347:Rint1 UTSW 5 23811772 missense probably damaging 1.00
R8791:Rint1 UTSW 5 23800596 missense probably damaging 0.99
R8900:Rint1 UTSW 5 23811884 missense possibly damaging 0.77
R8916:Rint1 UTSW 5 23787828 unclassified probably benign
Z1088:Rint1 UTSW 5 23805314 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGAAAACTTTGAGTTCTGTTGGAACGTG -3'
(R):5'- GTGTTCAAAATGCAACTGCTTAGCCT -3'

Sequencing Primer
(F):5'- GGAACGTGTTTTTGGAAAAGTC -3'
(R):5'- cagagggctatacagggaaac -3'
Posted On2014-04-13