Incidental Mutation 'R1552:Hadhb'
ID169993
Institutional Source Beutler Lab
Gene Symbol Hadhb
Ensembl Gene ENSMUSG00000059447
Gene Namehydroxyacyl-Coenzyme A dehydrogenase/3-ketoacyl-Coenzyme A thiolase/enoyl-Coenzyme A hydratase (trifunctional protein), beta subunit
Synonyms4930479F15Rik, Mtpb
MMRRC Submission 039591-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.724) question?
Stock #R1552 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location30155248-30184593 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 30176933 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 287 (L287Q)
Ref Sequence ENSEMBL: ENSMUSP00000110434 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026841] [ENSMUST00000114783] [ENSMUST00000114786] [ENSMUST00000123980] [ENSMUST00000197109]
Predicted Effect probably null
Transcript: ENSMUST00000026841
AA Change: L287Q

PolyPhen 2 Score 0.658 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000026841
Gene: ENSMUSG00000059447
AA Change: L287Q

DomainStartEndE-ValueType
Pfam:Thiolase_N 52 325 4.6e-96 PFAM
Pfam:ketoacyl-synt 86 193 1.8e-10 PFAM
Pfam:Thiolase_C 332 472 1.5e-51 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000114783
AA Change: L287Q

PolyPhen 2 Score 0.658 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000110431
Gene: ENSMUSG00000059447
AA Change: L287Q

DomainStartEndE-ValueType
Pfam:Thiolase_N 55 325 1.4e-90 PFAM
Pfam:ketoacyl-synt 90 194 1.4e-10 PFAM
Pfam:Thiolase_C 332 472 1.3e-51 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000114786
AA Change: L287Q

PolyPhen 2 Score 0.658 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000110434
Gene: ENSMUSG00000059447
AA Change: L287Q

DomainStartEndE-ValueType
Pfam:Thiolase_N 52 325 4.6e-96 PFAM
Pfam:ketoacyl-synt 86 193 1.8e-10 PFAM
Pfam:Thiolase_C 332 472 1.5e-51 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122934
Predicted Effect probably benign
Transcript: ENSMUST00000123980
SMART Domains Protein: ENSMUSP00000118296
Gene: ENSMUSG00000059447

DomainStartEndE-ValueType
Pfam:Thiolase_N 52 129 3.7e-20 PFAM
Pfam:Thiolase_N 119 173 3.3e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133414
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141236
Predicted Effect probably benign
Transcript: ENSMUST00000197109
Meta Mutation Damage Score 0.5967 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.7%
Validation Efficiency 97% (71/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the beta subunit of the mitochondrial trifunctional protein, which catalyzes the last three steps of mitochondrial beta-oxidation of long chain fatty acids. The mitochondrial membrane-bound heterocomplex is composed of four alpha and four beta subunits, with the beta subunit catalyzing the 3-ketoacyl-CoA thiolase activity. The encoded protein can also bind RNA and decreases the stability of some mRNAs. The genes of the alpha and beta subunits of the mitochondrial trifunctional protein are located adjacent to each other in the human genome in a head-to-head orientation. Mutations in this gene result in trifunctional protein deficiency. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for an ENU-induced mutation display reduced postnatal weight gain, multifocal cardiac fibrosis and hepatic steatosis, and develop cardiac arrhythmias that range from a prolonged PR interval to complete atrioventricular dissociation and lead to sudden between 9 and 16 months of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810046K07Rik T A 9: 51,291,570 S95C probably damaging Het
Abcc5 T A 16: 20,398,867 I365F probably damaging Het
Abhd15 T C 11: 77,515,407 L70P probably damaging Het
Adam18 A C 8: 24,646,361 H381Q probably benign Het
Ankfy1 T C 11: 72,754,495 probably null Het
Arcn1 C T 9: 44,758,994 A112T probably damaging Het
Calhm1 C T 19: 47,141,201 R294H probably benign Het
Ccdc121 A G 1: 181,510,991 L132P probably damaging Het
Cdk5rap1 T C 2: 154,370,695 E81G probably benign Het
Cep170 T C 1: 176,782,494 probably benign Het
Cep350 C T 1: 155,910,738 R1454Q possibly damaging Het
Chrna3 C A 9: 55,015,908 E205D probably benign Het
Chst5 T C 8: 111,890,280 D236G probably damaging Het
Coro1a T C 7: 126,699,952 N367D probably benign Het
Cyp3a16 T C 5: 145,436,536 I474V probably benign Het
Cyth3 G A 5: 143,697,750 V87I probably benign Het
Dclk3 C A 9: 111,488,579 T761K probably damaging Het
Dvl2 T A 11: 70,006,372 M300K possibly damaging Het
Eefsec C T 6: 88,376,200 probably benign Het
Exog T C 9: 119,445,110 S54P unknown Het
Fasn A G 11: 120,818,558 S519P probably damaging Het
Gas8 G A 8: 123,520,646 A16T probably benign Het
Got2 A G 8: 95,869,494 S333P probably benign Het
Ift57 A G 16: 49,759,353 T211A probably benign Het
Il1rap A G 16: 26,722,434 E475G possibly damaging Het
Ilkap A T 1: 91,384,594 D11E probably damaging Het
Impact T C 18: 12,984,280 S137P probably benign Het
Jarid2 T C 13: 44,911,199 V920A probably damaging Het
Kcnk18 A T 19: 59,235,458 H345L probably damaging Het
Kdm4d A T 9: 14,464,029 Y178N probably damaging Het
Klk1b1 A G 7: 43,969,343 Y48C probably damaging Het
Klra5 G T 6: 129,909,885 T60K probably damaging Het
Kng2 A T 16: 22,987,520 L643H probably damaging Het
Lamb3 A G 1: 193,330,759 probably null Het
Lingo2 A G 4: 35,708,315 V555A probably damaging Het
Mbd5 T C 2: 49,272,934 S251P probably damaging Het
Mc4r T C 18: 66,859,695 S116G probably benign Het
Mipol1 T C 12: 57,306,088 V71A possibly damaging Het
Myo15b A C 11: 115,866,635 S1104R probably benign Het
Nek1 T A 8: 61,006,737 D26E probably damaging Het
Neu1 C T 17: 34,932,113 probably benign Het
Npffr2 T C 5: 89,583,116 S302P possibly damaging Het
Olfr912 T C 9: 38,581,379 M34T probably benign Het
Palmd T A 3: 116,948,040 probably benign Het
Pcdh8 A T 14: 79,770,607 V172E probably benign Het
Pnpla6 C A 8: 3,522,403 Q291K probably damaging Het
Prkch T C 12: 73,702,546 F357L probably benign Het
Ptprj A T 2: 90,471,153 Y212N probably damaging Het
Reln G T 5: 21,960,378 H2061N probably benign Het
Rint1 T A 5: 23,800,658 S113T probably benign Het
Rnf38 G C 4: 44,142,468 probably null Het
Slc30a4 T A 2: 122,686,016 I374L probably benign Het
Slfn10-ps T C 11: 83,029,850 noncoding transcript Het
Smcp A T 3: 92,584,403 C46S unknown Het
Smu1 A C 4: 40,748,570 V240G probably damaging Het
Srsf5 A G 12: 80,949,745 probably benign Het
Stn1 T C 19: 47,536,373 probably null Het
Stx18 A G 5: 38,104,991 E63G probably damaging Het
Tas2r130 A G 6: 131,630,167 Y222H probably benign Het
Tescl G T 7: 24,333,333 P189Q probably benign Het
Tlr1 A G 5: 64,926,860 S125P probably damaging Het
Ugt2a2 G T 5: 87,462,021 D566E possibly damaging Het
Uhrf1bp1 T C 17: 27,890,071 F1088S possibly damaging Het
Unc13b A T 4: 43,237,144 T3405S probably damaging Het
Upf1 G A 8: 70,333,059 Q1046* probably null Het
Wwox T A 8: 114,445,350 Y61* probably null Het
Zfhx4 C T 3: 5,403,110 T2776M probably damaging Het
Zranb3 G A 1: 127,960,751 probably benign Het
Other mutations in Hadhb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02306:Hadhb APN 5 30166749 missense probably null 0.99
IGL02472:Hadhb APN 5 30184063 missense possibly damaging 0.68
R0110:Hadhb UTSW 5 30169485 splice site probably benign
R0481:Hadhb UTSW 5 30168545 missense probably damaging 1.00
R0578:Hadhb UTSW 5 30178806 missense probably benign
R1483:Hadhb UTSW 5 30169494 critical splice acceptor site probably null
R1616:Hadhb UTSW 5 30166715 missense probably damaging 1.00
R1926:Hadhb UTSW 5 30180937 missense possibly damaging 0.94
R2064:Hadhb UTSW 5 30173798 splice site probably null
R5066:Hadhb UTSW 5 30164096 intron probably benign
R5298:Hadhb UTSW 5 30177011 critical splice donor site probably null
R6216:Hadhb UTSW 5 30174931 missense probably benign 0.00
R6787:Hadhb UTSW 5 30155249 unclassified probably benign
R8480:Hadhb UTSW 5 30168570 critical splice donor site probably null
R8802:Hadhb UTSW 5 30173833 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGACTGCTGCTCAGGAAGGTCAAG -3'
(R):5'- TGTATTTTAAGCCTCCAACCACACGC -3'

Sequencing Primer
(F):5'- ccccagaaagagcagcag -3'
(R):5'- AGCAAATTTGCTGCAGGC -3'
Posted On2014-04-13