Incidental Mutation 'R1552:Stx18'
ID169994
Institutional Source Beutler Lab
Gene Symbol Stx18
Ensembl Gene ENSMUSG00000029125
Gene Namesyntaxin 18
Synonyms1810035L21Rik, 4933425D03Rik
MMRRC Submission 039591-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1552 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location38038742-38137765 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 38104991 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 63 (E63G)
Ref Sequence ENSEMBL: ENSMUSP00000118218 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031008] [ENSMUST00000042146] [ENSMUST00000114126] [ENSMUST00000146864] [ENSMUST00000154929] [ENSMUST00000202412]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031008
AA Change: E117G

PolyPhen 2 Score 0.862 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000031008
Gene: ENSMUSG00000029125
AA Change: E117G

DomainStartEndE-ValueType
Pfam:Syntaxin-18_N 3 96 4.1e-26 PFAM
low complexity region 196 209 N/A INTRINSIC
coiled coil region 229 259 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000042146
AA Change: E117G

PolyPhen 2 Score 0.862 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000038205
Gene: ENSMUSG00000029125
AA Change: E117G

DomainStartEndE-ValueType
Pfam:Syntaxin-18_N 3 96 4.1e-26 PFAM
low complexity region 170 183 N/A INTRINSIC
coiled coil region 203 233 N/A INTRINSIC
transmembrane domain 284 306 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114126
AA Change: E117G

PolyPhen 2 Score 0.862 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000109761
Gene: ENSMUSG00000029125
AA Change: E117G

DomainStartEndE-ValueType
Pfam:Syntaxin-18_N 3 96 3.4e-24 PFAM
low complexity region 196 209 N/A INTRINSIC
coiled coil region 229 259 N/A INTRINSIC
transmembrane domain 310 332 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000146864
AA Change: E36G

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000143909
Gene: ENSMUSG00000029125
AA Change: E36G

DomainStartEndE-ValueType
low complexity region 115 128 N/A INTRINSIC
coiled coil region 148 178 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000154929
AA Change: E63G

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000118218
Gene: ENSMUSG00000029125
AA Change: E63G

DomainStartEndE-ValueType
low complexity region 142 155 N/A INTRINSIC
coiled coil region 175 205 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000202412
AA Change: E63G

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
Meta Mutation Damage Score 0.6076 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.7%
Validation Efficiency 97% (71/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the syntaxin family of soluble N-ethylmaleimide-sensitive factor attachment protein receptors (SNAREs) which is part of a membrane tethering complex that includes other SNAREs and several peripheral membrane proteins, and is involved in vesicular transport between the endoplasmic reticulum (ER) and the Golgi complex. The encoded protein is important for the organization of the smooth, rough, and exit site ER subdomains. A pseudogene of this gene has been identified. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810046K07Rik T A 9: 51,291,570 S95C probably damaging Het
Abcc5 T A 16: 20,398,867 I365F probably damaging Het
Abhd15 T C 11: 77,515,407 L70P probably damaging Het
Adam18 A C 8: 24,646,361 H381Q probably benign Het
Ankfy1 T C 11: 72,754,495 probably null Het
Arcn1 C T 9: 44,758,994 A112T probably damaging Het
Calhm1 C T 19: 47,141,201 R294H probably benign Het
Ccdc121 A G 1: 181,510,991 L132P probably damaging Het
Cdk5rap1 T C 2: 154,370,695 E81G probably benign Het
Cep170 T C 1: 176,782,494 probably benign Het
Cep350 C T 1: 155,910,738 R1454Q possibly damaging Het
Chrna3 C A 9: 55,015,908 E205D probably benign Het
Chst5 T C 8: 111,890,280 D236G probably damaging Het
Coro1a T C 7: 126,699,952 N367D probably benign Het
Cyp3a16 T C 5: 145,436,536 I474V probably benign Het
Cyth3 G A 5: 143,697,750 V87I probably benign Het
Dclk3 C A 9: 111,488,579 T761K probably damaging Het
Dvl2 T A 11: 70,006,372 M300K possibly damaging Het
Eefsec C T 6: 88,376,200 probably benign Het
Exog T C 9: 119,445,110 S54P unknown Het
Fasn A G 11: 120,818,558 S519P probably damaging Het
Gas8 G A 8: 123,520,646 A16T probably benign Het
Got2 A G 8: 95,869,494 S333P probably benign Het
Hadhb T A 5: 30,176,933 L287Q probably null Het
Ift57 A G 16: 49,759,353 T211A probably benign Het
Il1rap A G 16: 26,722,434 E475G possibly damaging Het
Ilkap A T 1: 91,384,594 D11E probably damaging Het
Impact T C 18: 12,984,280 S137P probably benign Het
Jarid2 T C 13: 44,911,199 V920A probably damaging Het
Kcnk18 A T 19: 59,235,458 H345L probably damaging Het
Kdm4d A T 9: 14,464,029 Y178N probably damaging Het
Klk1b1 A G 7: 43,969,343 Y48C probably damaging Het
Klra5 G T 6: 129,909,885 T60K probably damaging Het
Kng2 A T 16: 22,987,520 L643H probably damaging Het
Lamb3 A G 1: 193,330,759 probably null Het
Lingo2 A G 4: 35,708,315 V555A probably damaging Het
Mbd5 T C 2: 49,272,934 S251P probably damaging Het
Mc4r T C 18: 66,859,695 S116G probably benign Het
Mipol1 T C 12: 57,306,088 V71A possibly damaging Het
Myo15b A C 11: 115,866,635 S1104R probably benign Het
Nek1 T A 8: 61,006,737 D26E probably damaging Het
Neu1 C T 17: 34,932,113 probably benign Het
Npffr2 T C 5: 89,583,116 S302P possibly damaging Het
Olfr912 T C 9: 38,581,379 M34T probably benign Het
Palmd T A 3: 116,948,040 probably benign Het
Pcdh8 A T 14: 79,770,607 V172E probably benign Het
Pnpla6 C A 8: 3,522,403 Q291K probably damaging Het
Prkch T C 12: 73,702,546 F357L probably benign Het
Ptprj A T 2: 90,471,153 Y212N probably damaging Het
Reln G T 5: 21,960,378 H2061N probably benign Het
Rint1 T A 5: 23,800,658 S113T probably benign Het
Rnf38 G C 4: 44,142,468 probably null Het
Slc30a4 T A 2: 122,686,016 I374L probably benign Het
Slfn10-ps T C 11: 83,029,850 noncoding transcript Het
Smcp A T 3: 92,584,403 C46S unknown Het
Smu1 A C 4: 40,748,570 V240G probably damaging Het
Srsf5 A G 12: 80,949,745 probably benign Het
Stn1 T C 19: 47,536,373 probably null Het
Tas2r130 A G 6: 131,630,167 Y222H probably benign Het
Tescl G T 7: 24,333,333 P189Q probably benign Het
Tlr1 A G 5: 64,926,860 S125P probably damaging Het
Ugt2a2 G T 5: 87,462,021 D566E possibly damaging Het
Uhrf1bp1 T C 17: 27,890,071 F1088S possibly damaging Het
Unc13b A T 4: 43,237,144 T3405S probably damaging Het
Upf1 G A 8: 70,333,059 Q1046* probably null Het
Wwox T A 8: 114,445,350 Y61* probably null Het
Zfhx4 C T 3: 5,403,110 T2776M probably damaging Het
Zranb3 G A 1: 127,960,751 probably benign Het
Other mutations in Stx18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01782:Stx18 APN 5 38106611 missense possibly damaging 0.86
IGL02123:Stx18 APN 5 38128103 missense probably damaging 1.00
IGL03107:Stx18 APN 5 38136311 missense probably damaging 1.00
IGL03187:Stx18 APN 5 38126983 missense possibly damaging 0.94
R0025:Stx18 UTSW 5 38092564 missense probably damaging 1.00
R0025:Stx18 UTSW 5 38092564 missense probably damaging 1.00
R0414:Stx18 UTSW 5 38105005 splice site probably benign
R0713:Stx18 UTSW 5 38106671 splice site probably null
R1147:Stx18 UTSW 5 38126923 splice site probably benign
R1725:Stx18 UTSW 5 38135255 missense probably damaging 1.00
R1929:Stx18 UTSW 5 38128039 splice site probably null
R2020:Stx18 UTSW 5 38135244 missense probably damaging 1.00
R4678:Stx18 UTSW 5 38136368 unclassified probably benign
R5247:Stx18 UTSW 5 38106633 missense probably damaging 1.00
R6056:Stx18 UTSW 5 38106564 missense probably damaging 0.96
R6330:Stx18 UTSW 5 38126917 splice site probably null
R6860:Stx18 UTSW 5 38104891 missense possibly damaging 0.62
R7060:Stx18 UTSW 5 38121255 missense possibly damaging 0.87
R7285:Stx18 UTSW 5 38104907 missense possibly damaging 0.91
R7351:Stx18 UTSW 5 38039411 missense probably benign 0.00
R8310:Stx18 UTSW 5 38128039 splice site probably null
R8329:Stx18 UTSW 5 38128106 nonsense probably null
X0026:Stx18 UTSW 5 38104966 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCCTCTGTTCCTAGCAAAGCTGTG -3'
(R):5'- ACAATCTGGTCCCTCTGACCTTGG -3'

Sequencing Primer
(F):5'- tccactctccaaaccattctc -3'
(R):5'- AGAAAAGTCCTTCCCATTCCTG -3'
Posted On2014-04-13