Incidental Mutation 'R1552:Cyth3'
ID169999
Institutional Source Beutler Lab
Gene Symbol Cyth3
Ensembl Gene ENSMUSG00000018001
Gene Namecytohesin 3
SynonymsGrp1, Pscd3, cytohesin 3
MMRRC Submission 039591-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.237) question?
Stock #R1552 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location143622447-143710250 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 143697750 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 87 (V87I)
Ref Sequence ENSEMBL: ENSMUSP00000106355 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110727] [ENSMUST00000116456]
Predicted Effect probably benign
Transcript: ENSMUST00000110727
AA Change: V87I

PolyPhen 2 Score 0.119 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000106355
Gene: ENSMUSG00000018001
AA Change: V87I

DomainStartEndE-ValueType
Sec7 15 200 1.5e-106 SMART
PH 217 334 1.1e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000116456
AA Change: V135I

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000112157
Gene: ENSMUSG00000018001
AA Change: V135I

DomainStartEndE-ValueType
low complexity region 3 10 N/A INTRINSIC
low complexity region 14 35 N/A INTRINSIC
Sec7 63 248 3.21e-104 SMART
PH 265 382 2.36e-24 SMART
Meta Mutation Damage Score 0.5613 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.7%
Validation Efficiency 97% (71/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the PSCD (pleckstrin homology, Sec7 and coiled-coil domains) family. PSCD family members have identical structural organization that consists of an N-terminal coiled-coil motif, a central Sec7 domain, and a C-terminal pleckstrin homology (PH) domain. The coiled-coil motif is involved in homodimerization, the Sec7 domain contains guanine-nucleotide exchange protein (GEP) activity, and the PH domain interacts with phospholipids and is responsible for association of PSCDs with membranes. Members of this family appear to mediate the regulation of protein sorting and membrane trafficking. This encoded protein is involved in the control of Golgi structure and function, and it may have a physiological role in regulating ADP-ribosylation factor protein 6 (ARF) functions, in addition to acting on ARF1. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810046K07Rik T A 9: 51,291,570 S95C probably damaging Het
Abcc5 T A 16: 20,398,867 I365F probably damaging Het
Abhd15 T C 11: 77,515,407 L70P probably damaging Het
Adam18 A C 8: 24,646,361 H381Q probably benign Het
Ankfy1 T C 11: 72,754,495 probably null Het
Arcn1 C T 9: 44,758,994 A112T probably damaging Het
Calhm1 C T 19: 47,141,201 R294H probably benign Het
Ccdc121 A G 1: 181,510,991 L132P probably damaging Het
Cdk5rap1 T C 2: 154,370,695 E81G probably benign Het
Cep170 T C 1: 176,782,494 probably benign Het
Cep350 C T 1: 155,910,738 R1454Q possibly damaging Het
Chrna3 C A 9: 55,015,908 E205D probably benign Het
Chst5 T C 8: 111,890,280 D236G probably damaging Het
Coro1a T C 7: 126,699,952 N367D probably benign Het
Cyp3a16 T C 5: 145,436,536 I474V probably benign Het
Dclk3 C A 9: 111,488,579 T761K probably damaging Het
Dvl2 T A 11: 70,006,372 M300K possibly damaging Het
Eefsec C T 6: 88,376,200 probably benign Het
Exog T C 9: 119,445,110 S54P unknown Het
Fasn A G 11: 120,818,558 S519P probably damaging Het
Gas8 G A 8: 123,520,646 A16T probably benign Het
Got2 A G 8: 95,869,494 S333P probably benign Het
Hadhb T A 5: 30,176,933 L287Q probably null Het
Ift57 A G 16: 49,759,353 T211A probably benign Het
Il1rap A G 16: 26,722,434 E475G possibly damaging Het
Ilkap A T 1: 91,384,594 D11E probably damaging Het
Impact T C 18: 12,984,280 S137P probably benign Het
Jarid2 T C 13: 44,911,199 V920A probably damaging Het
Kcnk18 A T 19: 59,235,458 H345L probably damaging Het
Kdm4d A T 9: 14,464,029 Y178N probably damaging Het
Klk1b1 A G 7: 43,969,343 Y48C probably damaging Het
Klra5 G T 6: 129,909,885 T60K probably damaging Het
Kng2 A T 16: 22,987,520 L643H probably damaging Het
Lamb3 A G 1: 193,330,759 probably null Het
Lingo2 A G 4: 35,708,315 V555A probably damaging Het
Mbd5 T C 2: 49,272,934 S251P probably damaging Het
Mc4r T C 18: 66,859,695 S116G probably benign Het
Mipol1 T C 12: 57,306,088 V71A possibly damaging Het
Myo15b A C 11: 115,866,635 S1104R probably benign Het
Nek1 T A 8: 61,006,737 D26E probably damaging Het
Neu1 C T 17: 34,932,113 probably benign Het
Npffr2 T C 5: 89,583,116 S302P possibly damaging Het
Olfr912 T C 9: 38,581,379 M34T probably benign Het
Palmd T A 3: 116,948,040 probably benign Het
Pcdh8 A T 14: 79,770,607 V172E probably benign Het
Pnpla6 C A 8: 3,522,403 Q291K probably damaging Het
Prkch T C 12: 73,702,546 F357L probably benign Het
Ptprj A T 2: 90,471,153 Y212N probably damaging Het
Reln G T 5: 21,960,378 H2061N probably benign Het
Rint1 T A 5: 23,800,658 S113T probably benign Het
Rnf38 G C 4: 44,142,468 probably null Het
Slc30a4 T A 2: 122,686,016 I374L probably benign Het
Slfn10-ps T C 11: 83,029,850 noncoding transcript Het
Smcp A T 3: 92,584,403 C46S unknown Het
Smu1 A C 4: 40,748,570 V240G probably damaging Het
Srsf5 A G 12: 80,949,745 probably benign Het
Stn1 T C 19: 47,536,373 probably null Het
Stx18 A G 5: 38,104,991 E63G probably damaging Het
Tas2r130 A G 6: 131,630,167 Y222H probably benign Het
Tescl G T 7: 24,333,333 P189Q probably benign Het
Tlr1 A G 5: 64,926,860 S125P probably damaging Het
Ugt2a2 G T 5: 87,462,021 D566E possibly damaging Het
Uhrf1bp1 T C 17: 27,890,071 F1088S possibly damaging Het
Unc13b A T 4: 43,237,144 T3405S probably damaging Het
Upf1 G A 8: 70,333,059 Q1046* probably null Het
Wwox T A 8: 114,445,350 Y61* probably null Het
Zfhx4 C T 3: 5,403,110 T2776M probably damaging Het
Zranb3 G A 1: 127,960,751 probably benign Het
Other mutations in Cyth3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00953:Cyth3 APN 5 143707165 splice site probably null
IGL01340:Cyth3 APN 5 143684435 nonsense probably null
IGL01372:Cyth3 APN 5 143692638 missense possibly damaging 0.93
IGL02092:Cyth3 APN 5 143707385 splice site probably benign
IGL02850:Cyth3 APN 5 143686504 missense probably damaging 0.97
IGL02892:Cyth3 APN 5 143707437 missense possibly damaging 0.86
R0373:Cyth3 UTSW 5 143684426 utr 5 prime probably benign
R0726:Cyth3 UTSW 5 143692642 missense probably benign 0.00
R1217:Cyth3 UTSW 5 143702820 missense probably damaging 1.00
R1623:Cyth3 UTSW 5 143701372 missense probably damaging 1.00
R1873:Cyth3 UTSW 5 143697761 missense possibly damaging 0.54
R3788:Cyth3 UTSW 5 143636543 intron probably benign
R4736:Cyth3 UTSW 5 143684479 critical splice donor site probably null
R6500:Cyth3 UTSW 5 143707840 missense probably damaging 0.97
R6824:Cyth3 UTSW 5 143686510 missense probably damaging 1.00
R7105:Cyth3 UTSW 5 143707272 missense probably benign 0.07
R7143:Cyth3 UTSW 5 143684396 missense unknown
R7767:Cyth3 UTSW 5 143707474 missense probably damaging 1.00
R7839:Cyth3 UTSW 5 143697754 missense probably benign 0.01
R8220:Cyth3 UTSW 5 143701589 splice site probably null
R8497:Cyth3 UTSW 5 143692573 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TGTCATAGGTAGAGCTGGCCTGAAG -3'
(R):5'- AGGACTGCTAAGTGTCACACAGGAG -3'

Sequencing Primer
(F):5'- agactctctcaaaagagcaaaac -3'
(R):5'- TGTCACACAGGAGAGGGC -3'
Posted On2014-04-13