Incidental Mutation 'R1552:Dvl2'
ID170024
Institutional Source Beutler Lab
Gene Symbol Dvl2
Ensembl Gene ENSMUSG00000020888
Gene Namedishevelled segment polarity protein 2
Synonyms
MMRRC Submission 039591-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.846) question?
Stock #R1552 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location70000595-70012301 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 70006372 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 300 (M300K)
Ref Sequence ENSEMBL: ENSMUSP00000140073 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018718] [ENSMUST00000019362] [ENSMUST00000102574] [ENSMUST00000102575] [ENSMUST00000190940]
Predicted Effect probably benign
Transcript: ENSMUST00000018718
SMART Domains Protein: ENSMUSP00000018718
Gene: ENSMUSG00000018574

DomainStartEndE-ValueType
Pfam:Acyl-CoA_dh_N 74 188 4.4e-22 PFAM
Pfam:Acyl-CoA_dh_M 192 245 5.1e-20 PFAM
Pfam:Acyl-CoA_dh_1 306 455 6.7e-41 PFAM
Pfam:Acyl-CoA_dh_2 321 445 2.8e-12 PFAM
Blast:HisKA 460 557 6e-10 BLAST
low complexity region 558 569 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000019362
AA Change: M300K

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000019362
Gene: ENSMUSG00000020888
AA Change: M300K

DomainStartEndE-ValueType
DAX 11 93 2.31e-56 SMART
Pfam:Dishevelled 103 263 1.5e-60 PFAM
PDZ 276 355 1.65e-15 SMART
low complexity region 395 407 N/A INTRINSIC
DEP 433 507 6.6e-29 SMART
Pfam:Dsh_C 515 726 1.1e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102574
SMART Domains Protein: ENSMUSP00000099634
Gene: ENSMUSG00000018574

DomainStartEndE-ValueType
Pfam:Acyl-CoA_dh_N 96 210 2.5e-25 PFAM
Pfam:Acyl-CoA_dh_M 214 316 5.5e-25 PFAM
Pfam:Acyl-CoA_dh_1 328 477 2.5e-41 PFAM
Pfam:Acyl-CoA_dh_2 343 467 8.7e-14 PFAM
Blast:HisKA 482 579 7e-10 BLAST
low complexity region 580 591 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000102575
AA Change: M300K

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000099635
Gene: ENSMUSG00000020888
AA Change: M300K

DomainStartEndE-ValueType
DAX 11 93 2.31e-56 SMART
low complexity region 112 122 N/A INTRINSIC
Pfam:Dishevelled 160 232 8.1e-27 PFAM
low complexity region 250 262 N/A INTRINSIC
PDZ 276 355 1.65e-15 SMART
low complexity region 395 407 N/A INTRINSIC
DEP 433 507 6.6e-29 SMART
Pfam:Dsh_C 515 726 1.3e-79 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130820
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134516
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135422
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146129
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149477
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152732
Predicted Effect possibly damaging
Transcript: ENSMUST00000190940
AA Change: M300K

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000140073
Gene: ENSMUSG00000020888
AA Change: M300K

DomainStartEndE-ValueType
DAX 11 93 2.31e-56 SMART
low complexity region 112 122 N/A INTRINSIC
Pfam:Dishevelled 160 232 8.1e-27 PFAM
low complexity region 250 262 N/A INTRINSIC
PDZ 276 355 1.65e-15 SMART
low complexity region 395 407 N/A INTRINSIC
DEP 433 507 6.6e-29 SMART
Pfam:Dsh_C 515 726 1.3e-79 PFAM
Meta Mutation Damage Score 0.8216 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.7%
Validation Efficiency 97% (71/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the dishevelled (dsh) protein family. The vertebrate dsh proteins have approximately 40% amino acid sequence similarity with Drosophila dsh. This gene encodes a 90-kD protein that undergoes posttranslational phosphorylation to form a 95-kD cytoplasmic protein, which may play a role in the signal transduction pathway mediated by multiple Wnt proteins. The mechanisms of dishevelled function in Wnt signaling are likely to be conserved among metazoans. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mice show incomplete penetrance of perinatal lethality with surviving mice being predominantly female. Defects include cardiovascular outflow and neural tube abnormalities, malformations of vertebrae and ribs, and irregular somite segmentation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810046K07Rik T A 9: 51,291,570 S95C probably damaging Het
Abcc5 T A 16: 20,398,867 I365F probably damaging Het
Abhd15 T C 11: 77,515,407 L70P probably damaging Het
Adam18 A C 8: 24,646,361 H381Q probably benign Het
Ankfy1 T C 11: 72,754,495 probably null Het
Arcn1 C T 9: 44,758,994 A112T probably damaging Het
Calhm1 C T 19: 47,141,201 R294H probably benign Het
Ccdc121 A G 1: 181,510,991 L132P probably damaging Het
Cdk5rap1 T C 2: 154,370,695 E81G probably benign Het
Cep170 T C 1: 176,782,494 probably benign Het
Cep350 C T 1: 155,910,738 R1454Q possibly damaging Het
Chrna3 C A 9: 55,015,908 E205D probably benign Het
Chst5 T C 8: 111,890,280 D236G probably damaging Het
Coro1a T C 7: 126,699,952 N367D probably benign Het
Cyp3a16 T C 5: 145,436,536 I474V probably benign Het
Cyth3 G A 5: 143,697,750 V87I probably benign Het
Dclk3 C A 9: 111,488,579 T761K probably damaging Het
Eefsec C T 6: 88,376,200 probably benign Het
Exog T C 9: 119,445,110 S54P unknown Het
Fasn A G 11: 120,818,558 S519P probably damaging Het
Gas8 G A 8: 123,520,646 A16T probably benign Het
Got2 A G 8: 95,869,494 S333P probably benign Het
Hadhb T A 5: 30,176,933 L287Q probably null Het
Ift57 A G 16: 49,759,353 T211A probably benign Het
Il1rap A G 16: 26,722,434 E475G possibly damaging Het
Ilkap A T 1: 91,384,594 D11E probably damaging Het
Impact T C 18: 12,984,280 S137P probably benign Het
Jarid2 T C 13: 44,911,199 V920A probably damaging Het
Kcnk18 A T 19: 59,235,458 H345L probably damaging Het
Kdm4d A T 9: 14,464,029 Y178N probably damaging Het
Klk1b1 A G 7: 43,969,343 Y48C probably damaging Het
Klra5 G T 6: 129,909,885 T60K probably damaging Het
Kng2 A T 16: 22,987,520 L643H probably damaging Het
Lamb3 A G 1: 193,330,759 probably null Het
Lingo2 A G 4: 35,708,315 V555A probably damaging Het
Mbd5 T C 2: 49,272,934 S251P probably damaging Het
Mc4r T C 18: 66,859,695 S116G probably benign Het
Mipol1 T C 12: 57,306,088 V71A possibly damaging Het
Myo15b A C 11: 115,866,635 S1104R probably benign Het
Nek1 T A 8: 61,006,737 D26E probably damaging Het
Neu1 C T 17: 34,932,113 probably benign Het
Npffr2 T C 5: 89,583,116 S302P possibly damaging Het
Olfr912 T C 9: 38,581,379 M34T probably benign Het
Palmd T A 3: 116,948,040 probably benign Het
Pcdh8 A T 14: 79,770,607 V172E probably benign Het
Pnpla6 C A 8: 3,522,403 Q291K probably damaging Het
Prkch T C 12: 73,702,546 F357L probably benign Het
Ptprj A T 2: 90,471,153 Y212N probably damaging Het
Reln G T 5: 21,960,378 H2061N probably benign Het
Rint1 T A 5: 23,800,658 S113T probably benign Het
Rnf38 G C 4: 44,142,468 probably null Het
Slc30a4 T A 2: 122,686,016 I374L probably benign Het
Slfn10-ps T C 11: 83,029,850 noncoding transcript Het
Smcp A T 3: 92,584,403 C46S unknown Het
Smu1 A C 4: 40,748,570 V240G probably damaging Het
Srsf5 A G 12: 80,949,745 probably benign Het
Stn1 T C 19: 47,536,373 probably null Het
Stx18 A G 5: 38,104,991 E63G probably damaging Het
Tas2r130 A G 6: 131,630,167 Y222H probably benign Het
Tescl G T 7: 24,333,333 P189Q probably benign Het
Tlr1 A G 5: 64,926,860 S125P probably damaging Het
Ugt2a2 G T 5: 87,462,021 D566E possibly damaging Het
Uhrf1bp1 T C 17: 27,890,071 F1088S possibly damaging Het
Unc13b A T 4: 43,237,144 T3405S probably damaging Het
Upf1 G A 8: 70,333,059 Q1046* probably null Het
Wwox T A 8: 114,445,350 Y61* probably null Het
Zfhx4 C T 3: 5,403,110 T2776M probably damaging Het
Zranb3 G A 1: 127,960,751 probably benign Het
Other mutations in Dvl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01295:Dvl2 APN 11 70009584 missense possibly damaging 0.86
IGL01465:Dvl2 APN 11 70006354 missense probably damaging 1.00
IGL01920:Dvl2 APN 11 70008047 missense probably benign 0.02
IGL01985:Dvl2 APN 11 70008293 missense probably damaging 1.00
IGL02071:Dvl2 APN 11 70004800 splice site probably null
IGL02110:Dvl2 APN 11 70008016 splice site probably benign
IGL03132:Dvl2 APN 11 70005688 missense probably benign 0.01
R0076:Dvl2 UTSW 11 70008100 missense probably damaging 0.99
R0076:Dvl2 UTSW 11 70008100 missense probably damaging 0.99
R0331:Dvl2 UTSW 11 70006217 splice site probably benign
R0335:Dvl2 UTSW 11 70001035 splice site probably benign
R1187:Dvl2 UTSW 11 70006136 missense probably benign 0.05
R1726:Dvl2 UTSW 11 70009461 missense probably benign
R3103:Dvl2 UTSW 11 70008869 missense possibly damaging 0.82
R4688:Dvl2 UTSW 11 70007518 missense possibly damaging 0.82
R4812:Dvl2 UTSW 11 70011293 utr 3 prime probably benign
R5319:Dvl2 UTSW 11 70008131 missense possibly damaging 0.91
R5521:Dvl2 UTSW 11 70006407 missense probably damaging 0.98
R5647:Dvl2 UTSW 11 70009449 missense possibly damaging 0.91
R5721:Dvl2 UTSW 11 70005993 missense possibly damaging 0.95
R6053:Dvl2 UTSW 11 70005993 missense possibly damaging 0.95
R6812:Dvl2 UTSW 11 70000995 missense probably damaging 1.00
R6818:Dvl2 UTSW 11 70009273 missense probably damaging 0.98
R7843:Dvl2 UTSW 11 70008786 missense probably benign 0.04
R8079:Dvl2 UTSW 11 70007518 missense possibly damaging 0.95
R8398:Dvl2 UTSW 11 70008302 missense probably damaging 1.00
R8425:Dvl2 UTSW 11 70007847 missense probably damaging 1.00
R8880:Dvl2 UTSW 11 70007935 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- AGTGTCACCGATTCCACAATGTCTC -3'
(R):5'- TCGTACAGCATCGTCGTTGCTC -3'

Sequencing Primer
(F):5'- TCACGCTCAACATGGGTATG -3'
(R):5'- GTCGTTGCTCATGTTCTCAAAG -3'
Posted On2014-04-13