Incidental Mutation 'R1552:Srsf5'
ID170032
Institutional Source Beutler Lab
Gene Symbol Srsf5
Ensembl Gene ENSMUSG00000021134
Gene Nameserine/arginine-rich splicing factor 5
SynonymsSfrs5
MMRRC Submission 039591-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.589) question?
Stock #R1552 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location80945504-80950507 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 80949745 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151555 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094693] [ENSMUST00000095572] [ENSMUST00000110351] [ENSMUST00000110352] [ENSMUST00000110354] [ENSMUST00000110356] [ENSMUST00000138434] [ENSMUST00000218162]
Predicted Effect unknown
Transcript: ENSMUST00000094693
AA Change: T193A
SMART Domains Protein: ENSMUSP00000131323
Gene: ENSMUSG00000021134
AA Change: T193A

DomainStartEndE-ValueType
RRM 5 70 4.56e-18 SMART
low complexity region 73 105 N/A INTRINSIC
RRM 109 177 5.58e-13 SMART
low complexity region 180 230 N/A INTRINSIC
low complexity region 235 267 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000095572
SMART Domains Protein: ENSMUSP00000093229
Gene: ENSMUSG00000021135

DomainStartEndE-ValueType
Pfam:SBF 32 217 3.3e-47 PFAM
transmembrane domain 222 244 N/A INTRINSIC
transmembrane domain 282 304 N/A INTRINSIC
low complexity region 323 333 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000110351
AA Change: T194A
SMART Domains Protein: ENSMUSP00000105980
Gene: ENSMUSG00000021134
AA Change: T194A

DomainStartEndE-ValueType
RRM 5 70 4.56e-18 SMART
low complexity region 73 105 N/A INTRINSIC
RRM 109 177 5.58e-13 SMART
low complexity region 180 231 N/A INTRINSIC
low complexity region 236 268 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000110352
AA Change: T193A
SMART Domains Protein: ENSMUSP00000105981
Gene: ENSMUSG00000021134
AA Change: T193A

DomainStartEndE-ValueType
RRM 5 70 4.56e-18 SMART
low complexity region 73 105 N/A INTRINSIC
RRM 109 177 5.58e-13 SMART
low complexity region 180 230 N/A INTRINSIC
low complexity region 235 267 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000110354
AA Change: T194A
SMART Domains Protein: ENSMUSP00000105983
Gene: ENSMUSG00000021134
AA Change: T194A

DomainStartEndE-ValueType
RRM 5 70 4.56e-18 SMART
low complexity region 73 105 N/A INTRINSIC
RRM 109 177 5.58e-13 SMART
low complexity region 180 231 N/A INTRINSIC
low complexity region 236 268 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000110356
AA Change: T193A
SMART Domains Protein: ENSMUSP00000105985
Gene: ENSMUSG00000021134
AA Change: T193A

DomainStartEndE-ValueType
RRM 5 70 4.56e-18 SMART
low complexity region 73 105 N/A INTRINSIC
RRM 109 177 5.58e-13 SMART
low complexity region 180 230 N/A INTRINSIC
low complexity region 235 267 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125814
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133783
Predicted Effect probably benign
Transcript: ENSMUST00000138434
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151036
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151968
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152662
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153056
Predicted Effect probably benign
Transcript: ENSMUST00000218162
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219062
Meta Mutation Damage Score 0.0696 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.7%
Validation Efficiency 97% (71/73)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the serine/arginine (SR)-rich family of pre-mRNA splicing factors, which constitute part of the spliceosome. Each of these factors contains an RNA recognition motif (RRM) for binding RNA and an RS domain for binding other proteins. The RS domain is rich in serine and arginine residues and facilitates interaction between different SR splicing factors. In addition to being critical for mRNA splicing, the SR proteins have also been shown to be involved in mRNA export from the nucleus and in translation. [provided by RefSeq, Nov 2016]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810046K07Rik T A 9: 51,291,570 S95C probably damaging Het
Abcc5 T A 16: 20,398,867 I365F probably damaging Het
Abhd15 T C 11: 77,515,407 L70P probably damaging Het
Adam18 A C 8: 24,646,361 H381Q probably benign Het
Ankfy1 T C 11: 72,754,495 probably null Het
Arcn1 C T 9: 44,758,994 A112T probably damaging Het
Calhm1 C T 19: 47,141,201 R294H probably benign Het
Ccdc121 A G 1: 181,510,991 L132P probably damaging Het
Cdk5rap1 T C 2: 154,370,695 E81G probably benign Het
Cep170 T C 1: 176,782,494 probably benign Het
Cep350 C T 1: 155,910,738 R1454Q possibly damaging Het
Chrna3 C A 9: 55,015,908 E205D probably benign Het
Chst5 T C 8: 111,890,280 D236G probably damaging Het
Coro1a T C 7: 126,699,952 N367D probably benign Het
Cyp3a16 T C 5: 145,436,536 I474V probably benign Het
Cyth3 G A 5: 143,697,750 V87I probably benign Het
Dclk3 C A 9: 111,488,579 T761K probably damaging Het
Dvl2 T A 11: 70,006,372 M300K possibly damaging Het
Eefsec C T 6: 88,376,200 probably benign Het
Exog T C 9: 119,445,110 S54P unknown Het
Fasn A G 11: 120,818,558 S519P probably damaging Het
Gas8 G A 8: 123,520,646 A16T probably benign Het
Got2 A G 8: 95,869,494 S333P probably benign Het
Hadhb T A 5: 30,176,933 L287Q probably null Het
Ift57 A G 16: 49,759,353 T211A probably benign Het
Il1rap A G 16: 26,722,434 E475G possibly damaging Het
Ilkap A T 1: 91,384,594 D11E probably damaging Het
Impact T C 18: 12,984,280 S137P probably benign Het
Jarid2 T C 13: 44,911,199 V920A probably damaging Het
Kcnk18 A T 19: 59,235,458 H345L probably damaging Het
Kdm4d A T 9: 14,464,029 Y178N probably damaging Het
Klk1b1 A G 7: 43,969,343 Y48C probably damaging Het
Klra5 G T 6: 129,909,885 T60K probably damaging Het
Kng2 A T 16: 22,987,520 L643H probably damaging Het
Lamb3 A G 1: 193,330,759 probably null Het
Lingo2 A G 4: 35,708,315 V555A probably damaging Het
Mbd5 T C 2: 49,272,934 S251P probably damaging Het
Mc4r T C 18: 66,859,695 S116G probably benign Het
Mipol1 T C 12: 57,306,088 V71A possibly damaging Het
Myo15b A C 11: 115,866,635 S1104R probably benign Het
Nek1 T A 8: 61,006,737 D26E probably damaging Het
Neu1 C T 17: 34,932,113 probably benign Het
Npffr2 T C 5: 89,583,116 S302P possibly damaging Het
Olfr912 T C 9: 38,581,379 M34T probably benign Het
Palmd T A 3: 116,948,040 probably benign Het
Pcdh8 A T 14: 79,770,607 V172E probably benign Het
Pnpla6 C A 8: 3,522,403 Q291K probably damaging Het
Prkch T C 12: 73,702,546 F357L probably benign Het
Ptprj A T 2: 90,471,153 Y212N probably damaging Het
Reln G T 5: 21,960,378 H2061N probably benign Het
Rint1 T A 5: 23,800,658 S113T probably benign Het
Rnf38 G C 4: 44,142,468 probably null Het
Slc30a4 T A 2: 122,686,016 I374L probably benign Het
Slfn10-ps T C 11: 83,029,850 noncoding transcript Het
Smcp A T 3: 92,584,403 C46S unknown Het
Smu1 A C 4: 40,748,570 V240G probably damaging Het
Stn1 T C 19: 47,536,373 probably null Het
Stx18 A G 5: 38,104,991 E63G probably damaging Het
Tas2r130 A G 6: 131,630,167 Y222H probably benign Het
Tescl G T 7: 24,333,333 P189Q probably benign Het
Tlr1 A G 5: 64,926,860 S125P probably damaging Het
Ugt2a2 G T 5: 87,462,021 D566E possibly damaging Het
Uhrf1bp1 T C 17: 27,890,071 F1088S possibly damaging Het
Unc13b A T 4: 43,237,144 T3405S probably damaging Het
Upf1 G A 8: 70,333,059 Q1046* probably null Het
Wwox T A 8: 114,445,350 Y61* probably null Het
Zfhx4 C T 3: 5,403,110 T2776M probably damaging Het
Zranb3 G A 1: 127,960,751 probably benign Het
Other mutations in Srsf5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00907:Srsf5 APN 12 80947834 missense probably damaging 1.00
R0344:Srsf5 UTSW 12 80947524 missense probably benign 0.00
R0827:Srsf5 UTSW 12 80949540 missense probably damaging 1.00
R2519:Srsf5 UTSW 12 80949096 missense probably damaging 0.99
R4926:Srsf5 UTSW 12 80947301 utr 3 prime probably benign
R5505:Srsf5 UTSW 12 80949083 unclassified probably benign
R5786:Srsf5 UTSW 12 80949537 missense possibly damaging 0.48
R7810:Srsf5 UTSW 12 80949946 missense unknown
R8265:Srsf5 UTSW 12 80947336 missense possibly damaging 0.95
R8711:Srsf5 UTSW 12 80947554 missense possibly damaging 0.81
R8832:Srsf5 UTSW 12 80949504 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTTTGCGGATGCACATCGAC -3'
(R):5'- AAGAACCACGTTTCTGGCTCTTCTC -3'

Sequencing Primer
(F):5'- GACTGTTGATAATAGGCACCTGC -3'
(R):5'- TCTTCTCAGGCACAGGAGAC -3'
Posted On2014-04-13