Incidental Mutation 'R1552:Jarid2'
ID170033
Institutional Source Beutler Lab
Gene Symbol Jarid2
Ensembl Gene ENSMUSG00000038518
Gene Namejumonji, AT rich interactive domain 2
Synonymsjumonji, Jmj
MMRRC Submission 039591-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1552 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location44729474-44921643 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 44911199 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 920 (V920A)
Ref Sequence ENSEMBL: ENSMUSP00000134675 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044608] [ENSMUST00000173246] [ENSMUST00000173704] [ENSMUST00000173906]
Predicted Effect probably damaging
Transcript: ENSMUST00000044608
AA Change: V920A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037774
Gene: ENSMUSG00000038518
AA Change: V920A

DomainStartEndE-ValueType
low complexity region 86 99 N/A INTRINSIC
low complexity region 181 195 N/A INTRINSIC
low complexity region 265 285 N/A INTRINSIC
low complexity region 334 353 N/A INTRINSIC
JmjN 554 595 1.77e-20 SMART
ARID 616 707 4.96e-24 SMART
BRIGHT 620 712 1.7e-29 SMART
low complexity region 791 800 N/A INTRINSIC
JmjC 882 1046 1.04e-50 SMART
Pfam:zf-C5HC2 1137 1191 2.4e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000173246
AA Change: V920A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134205
Gene: ENSMUSG00000038518
AA Change: V920A

DomainStartEndE-ValueType
low complexity region 86 99 N/A INTRINSIC
low complexity region 181 195 N/A INTRINSIC
low complexity region 265 285 N/A INTRINSIC
low complexity region 334 353 N/A INTRINSIC
JmjN 554 595 1.77e-20 SMART
ARID 616 707 4.96e-24 SMART
BRIGHT 620 712 1.7e-29 SMART
low complexity region 791 800 N/A INTRINSIC
JmjC 882 1046 1.04e-50 SMART
Pfam:zf-C5HC2 1137 1191 2.4e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000173704
AA Change: V920A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134675
Gene: ENSMUSG00000038518
AA Change: V920A

DomainStartEndE-ValueType
low complexity region 86 99 N/A INTRINSIC
low complexity region 181 195 N/A INTRINSIC
low complexity region 265 285 N/A INTRINSIC
low complexity region 334 353 N/A INTRINSIC
JmjN 554 595 1.77e-20 SMART
ARID 616 707 4.96e-24 SMART
BRIGHT 620 712 1.7e-29 SMART
low complexity region 791 800 N/A INTRINSIC
JmjC 882 1046 1.04e-50 SMART
Pfam:zf-C5HC2 1137 1190 1e-10 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000173906
AA Change: V882A

PolyPhen 2 Score 0.785 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000134630
Gene: ENSMUSG00000038518
AA Change: V882A

DomainStartEndE-ValueType
low complexity region 48 61 N/A INTRINSIC
low complexity region 143 157 N/A INTRINSIC
low complexity region 227 247 N/A INTRINSIC
low complexity region 296 315 N/A INTRINSIC
JmjN 516 557 1.77e-20 SMART
ARID 578 669 4.96e-24 SMART
BRIGHT 582 674 1.7e-29 SMART
low complexity region 753 762 N/A INTRINSIC
JmjC 844 1008 1.04e-50 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174683
Meta Mutation Damage Score 0.4886 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.7%
Validation Efficiency 97% (71/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a Jumonji- and AT-rich interaction domain (ARID)-domain-containing protein. The encoded protein is a DNA-binding protein that functions as a transcriptional repressor. This protein interacts with the Polycomb repressive complex 2 (PRC2) which plays an essential role in regulating gene expression during embryonic development. This protein facilitates the recruitment of the PRC2 complex to target genes. Alternate splicing results in multiple transcript variants. Mutations in this gene are associated with chronic myeloid malignancies. [provided by RefSeq, May 2012]
PHENOTYPE: Homozygous mutants show strain-specific phenotypes, including embryonic death and defective neural tube closure, impaired hematopoiesis and hypoplasia of liver, thymus and spleen. Homozygotes for another mutation die at birth with cardiac defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810046K07Rik T A 9: 51,291,570 S95C probably damaging Het
Abcc5 T A 16: 20,398,867 I365F probably damaging Het
Abhd15 T C 11: 77,515,407 L70P probably damaging Het
Adam18 A C 8: 24,646,361 H381Q probably benign Het
Ankfy1 T C 11: 72,754,495 probably null Het
Arcn1 C T 9: 44,758,994 A112T probably damaging Het
Calhm1 C T 19: 47,141,201 R294H probably benign Het
Ccdc121 A G 1: 181,510,991 L132P probably damaging Het
Cdk5rap1 T C 2: 154,370,695 E81G probably benign Het
Cep170 T C 1: 176,782,494 probably benign Het
Cep350 C T 1: 155,910,738 R1454Q possibly damaging Het
Chrna3 C A 9: 55,015,908 E205D probably benign Het
Chst5 T C 8: 111,890,280 D236G probably damaging Het
Coro1a T C 7: 126,699,952 N367D probably benign Het
Cyp3a16 T C 5: 145,436,536 I474V probably benign Het
Cyth3 G A 5: 143,697,750 V87I probably benign Het
Dclk3 C A 9: 111,488,579 T761K probably damaging Het
Dvl2 T A 11: 70,006,372 M300K possibly damaging Het
Eefsec C T 6: 88,376,200 probably benign Het
Exog T C 9: 119,445,110 S54P unknown Het
Fasn A G 11: 120,818,558 S519P probably damaging Het
Gas8 G A 8: 123,520,646 A16T probably benign Het
Got2 A G 8: 95,869,494 S333P probably benign Het
Hadhb T A 5: 30,176,933 L287Q probably null Het
Ift57 A G 16: 49,759,353 T211A probably benign Het
Il1rap A G 16: 26,722,434 E475G possibly damaging Het
Ilkap A T 1: 91,384,594 D11E probably damaging Het
Impact T C 18: 12,984,280 S137P probably benign Het
Kcnk18 A T 19: 59,235,458 H345L probably damaging Het
Kdm4d A T 9: 14,464,029 Y178N probably damaging Het
Klk1b1 A G 7: 43,969,343 Y48C probably damaging Het
Klra5 G T 6: 129,909,885 T60K probably damaging Het
Kng2 A T 16: 22,987,520 L643H probably damaging Het
Lamb3 A G 1: 193,330,759 probably null Het
Lingo2 A G 4: 35,708,315 V555A probably damaging Het
Mbd5 T C 2: 49,272,934 S251P probably damaging Het
Mc4r T C 18: 66,859,695 S116G probably benign Het
Mipol1 T C 12: 57,306,088 V71A possibly damaging Het
Myo15b A C 11: 115,866,635 S1104R probably benign Het
Nek1 T A 8: 61,006,737 D26E probably damaging Het
Neu1 C T 17: 34,932,113 probably benign Het
Npffr2 T C 5: 89,583,116 S302P possibly damaging Het
Olfr912 T C 9: 38,581,379 M34T probably benign Het
Palmd T A 3: 116,948,040 probably benign Het
Pcdh8 A T 14: 79,770,607 V172E probably benign Het
Pnpla6 C A 8: 3,522,403 Q291K probably damaging Het
Prkch T C 12: 73,702,546 F357L probably benign Het
Ptprj A T 2: 90,471,153 Y212N probably damaging Het
Reln G T 5: 21,960,378 H2061N probably benign Het
Rint1 T A 5: 23,800,658 S113T probably benign Het
Rnf38 G C 4: 44,142,468 probably null Het
Slc30a4 T A 2: 122,686,016 I374L probably benign Het
Slfn10-ps T C 11: 83,029,850 noncoding transcript Het
Smcp A T 3: 92,584,403 C46S unknown Het
Smu1 A C 4: 40,748,570 V240G probably damaging Het
Srsf5 A G 12: 80,949,745 probably benign Het
Stn1 T C 19: 47,536,373 probably null Het
Stx18 A G 5: 38,104,991 E63G probably damaging Het
Tas2r130 A G 6: 131,630,167 Y222H probably benign Het
Tescl G T 7: 24,333,333 P189Q probably benign Het
Tlr1 A G 5: 64,926,860 S125P probably damaging Het
Ugt2a2 G T 5: 87,462,021 D566E possibly damaging Het
Uhrf1bp1 T C 17: 27,890,071 F1088S possibly damaging Het
Unc13b A T 4: 43,237,144 T3405S probably damaging Het
Upf1 G A 8: 70,333,059 Q1046* probably null Het
Wwox T A 8: 114,445,350 Y61* probably null Het
Zfhx4 C T 3: 5,403,110 T2776M probably damaging Het
Zranb3 G A 1: 127,960,751 probably benign Het
Other mutations in Jarid2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01572:Jarid2 APN 13 44884835 missense probably damaging 1.00
IGL02217:Jarid2 APN 13 44913201 missense probably damaging 1.00
IGL02378:Jarid2 APN 13 44914325 missense probably damaging 0.98
IGL02604:Jarid2 APN 13 44874401 missense probably damaging 1.00
IGL02865:Jarid2 APN 13 44910560 missense probably damaging 1.00
IGL02926:Jarid2 APN 13 44902929 missense probably benign 0.03
R0057:Jarid2 UTSW 13 44884856 missense probably damaging 0.96
R0426:Jarid2 UTSW 13 44840882 critical splice donor site probably null
R0545:Jarid2 UTSW 13 44902831 missense probably benign 0.10
R0562:Jarid2 UTSW 13 44902359 missense probably damaging 0.99
R1192:Jarid2 UTSW 13 44906545 missense probably damaging 1.00
R1241:Jarid2 UTSW 13 44884892 splice site probably benign
R1254:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R1464:Jarid2 UTSW 13 44848381 missense probably damaging 0.97
R1464:Jarid2 UTSW 13 44848381 missense probably damaging 0.97
R1728:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R1729:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R1730:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R1739:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R1783:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R1785:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R1844:Jarid2 UTSW 13 44902743 missense possibly damaging 0.71
R1896:Jarid2 UTSW 13 44884882 critical splice donor site probably null
R1965:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R1966:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R1995:Jarid2 UTSW 13 44874441 missense probably damaging 1.00
R2120:Jarid2 UTSW 13 44906336 missense probably benign 0.17
R2142:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R2172:Jarid2 UTSW 13 44902539 missense probably damaging 0.99
R2242:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R2245:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R3110:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R3111:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R3112:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R3115:Jarid2 UTSW 13 44896466 missense probably damaging 1.00
R3620:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R3704:Jarid2 UTSW 13 44902355 missense probably benign
R3802:Jarid2 UTSW 13 44902831 missense probably benign 0.10
R3804:Jarid2 UTSW 13 44902831 missense probably benign 0.10
R4126:Jarid2 UTSW 13 44902256 missense probably damaging 1.00
R4127:Jarid2 UTSW 13 44902256 missense probably damaging 1.00
R4128:Jarid2 UTSW 13 44902256 missense probably damaging 1.00
R4153:Jarid2 UTSW 13 44910426 missense probably damaging 1.00
R4844:Jarid2 UTSW 13 44913772 missense probably damaging 0.96
R5044:Jarid2 UTSW 13 44906565 missense probably damaging 1.00
R5329:Jarid2 UTSW 13 44906271 missense possibly damaging 0.49
R5632:Jarid2 UTSW 13 44896290 missense probably damaging 0.97
R5820:Jarid2 UTSW 13 44902301 missense possibly damaging 0.96
R6267:Jarid2 UTSW 13 44903063 missense possibly damaging 0.93
R6296:Jarid2 UTSW 13 44903063 missense possibly damaging 0.93
R6479:Jarid2 UTSW 13 44848289 missense probably benign 0.22
R6619:Jarid2 UTSW 13 44874396 missense probably damaging 1.00
R6633:Jarid2 UTSW 13 44884877 missense probably damaging 0.97
R6970:Jarid2 UTSW 13 44902985 missense probably damaging 1.00
R7020:Jarid2 UTSW 13 44884824 missense probably damaging 1.00
R7155:Jarid2 UTSW 13 44902462 missense probably damaging 1.00
R7223:Jarid2 UTSW 13 44896322 missense possibly damaging 0.89
R7265:Jarid2 UTSW 13 44902272 missense probably benign 0.29
R8321:Jarid2 UTSW 13 44848386 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGTGGACAGAGGCTCTTAAGCCAG -3'
(R):5'- AGCAGATTAGGCAGGCAATTCACAG -3'

Sequencing Primer
(F):5'- TGGGAGGAGGGCCAGAATAG -3'
(R):5'- GGGAAAGCACGTCTCTCTTC -3'
Posted On2014-04-13