Incidental Mutation 'R1552:Il1rap'
ID 170040
Institutional Source Beutler Lab
Gene Symbol Il1rap
Ensembl Gene ENSMUSG00000022514
Gene Name interleukin 1 receptor accessory protein
Synonyms IL-1RAcP, 6430709H04Rik, IL-1R AcP
MMRRC Submission 039591-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1552 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 26400454-26548867 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 26541184 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 475 (E475G)
Ref Sequence ENSEMBL: ENSMUSP00000128100 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023156] [ENSMUST00000096129] [ENSMUST00000166294]
AlphaFold Q61730
Predicted Effect probably benign
Transcript: ENSMUST00000023156
SMART Domains Protein: ENSMUSP00000023156
Gene: ENSMUSG00000022514

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 32 132 1.21e-2 SMART
IG 145 232 4.04e0 SMART
IG 251 350 1.46e-5 SMART
low complexity region 368 381 N/A INTRINSIC
TIR 404 549 5.29e-36 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000096129
AA Change: E475G

PolyPhen 2 Score 0.785 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000093843
Gene: ENSMUSG00000022514
AA Change: E475G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 32 132 1.21e-2 SMART
IG 145 232 4.04e0 SMART
IG 251 350 1.46e-5 SMART
low complexity region 368 381 N/A INTRINSIC
TIR 404 547 1.38e-25 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000166294
AA Change: E475G

PolyPhen 2 Score 0.785 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000128100
Gene: ENSMUSG00000022514
AA Change: E475G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 32 132 1.21e-2 SMART
IG 145 232 4.04e0 SMART
IG 251 350 1.46e-5 SMART
low complexity region 368 381 N/A INTRINSIC
TIR 404 547 1.38e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172522
Predicted Effect probably benign
Transcript: ENSMUST00000173136
SMART Domains Protein: ENSMUSP00000133294
Gene: ENSMUSG00000022514

DomainStartEndE-ValueType
Blast:TIR 2 154 3e-48 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174385
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174644
Meta Mutation Damage Score 0.1072 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.7%
Validation Efficiency 97% (71/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Interleukin 1 induces synthesis of acute phase and proinflammatory proteins during infection, tissue damage, or stress, by forming a complex at the cell membrane with an interleukin 1 receptor and an accessory protein. This gene encodes the interleukin 1 receptor accessory protein. The protein is a necessary part of the interleukin 1 receptor complex which initiates signalling events that result in the activation of interleukin 1-responsive genes. Alternative splicing of this gene results in two transcript variants encoding two different isoforms, one membrane-bound and one soluble. The ratio of soluble to membrane-bound forms increases during acute-phase induction or stress. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile and grossly normal but show no biological response to IL-1. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 T A 16: 20,217,617 (GRCm39) I365F probably damaging Het
Abhd15 T C 11: 77,406,233 (GRCm39) L70P probably damaging Het
Adam18 A C 8: 25,136,377 (GRCm39) H381Q probably benign Het
Ankfy1 T C 11: 72,645,321 (GRCm39) probably null Het
Arcn1 C T 9: 44,670,291 (GRCm39) A112T probably damaging Het
Bltp3a T C 17: 28,109,045 (GRCm39) F1088S possibly damaging Het
Calhm1 C T 19: 47,129,640 (GRCm39) R294H probably benign Het
Ccdc121rt1 A G 1: 181,338,556 (GRCm39) L132P probably damaging Het
Cdk5rap1 T C 2: 154,212,615 (GRCm39) E81G probably benign Het
Cep170 T C 1: 176,610,060 (GRCm39) probably benign Het
Cep350 C T 1: 155,786,484 (GRCm39) R1454Q possibly damaging Het
Chrna3 C A 9: 54,923,192 (GRCm39) E205D probably benign Het
Chst5 T C 8: 112,616,912 (GRCm39) D236G probably damaging Het
Coro1a T C 7: 126,299,124 (GRCm39) N367D probably benign Het
Cyp3a16 T C 5: 145,373,346 (GRCm39) I474V probably benign Het
Cyth3 G A 5: 143,683,505 (GRCm39) V87I probably benign Het
Dclk3 C A 9: 111,317,647 (GRCm39) T761K probably damaging Het
Dvl2 T A 11: 69,897,198 (GRCm39) M300K possibly damaging Het
Eefsec C T 6: 88,353,182 (GRCm39) probably benign Het
Exog T C 9: 119,274,176 (GRCm39) S54P unknown Het
Fasn A G 11: 120,709,384 (GRCm39) S519P probably damaging Het
Gas8 G A 8: 124,247,385 (GRCm39) A16T probably benign Het
Got2 A G 8: 96,596,122 (GRCm39) S333P probably benign Het
Hadhb T A 5: 30,381,931 (GRCm39) L287Q probably null Het
Ift57 A G 16: 49,579,716 (GRCm39) T211A probably benign Het
Ilkap A T 1: 91,312,316 (GRCm39) D11E probably damaging Het
Impact T C 18: 13,117,337 (GRCm39) S137P probably benign Het
Jarid2 T C 13: 45,064,675 (GRCm39) V920A probably damaging Het
Kcnk18 A T 19: 59,223,890 (GRCm39) H345L probably damaging Het
Kdm4d A T 9: 14,375,325 (GRCm39) Y178N probably damaging Het
Klk1b1 A G 7: 43,618,767 (GRCm39) Y48C probably damaging Het
Klra5 G T 6: 129,886,848 (GRCm39) T60K probably damaging Het
Kng2 A T 16: 22,806,270 (GRCm39) L643H probably damaging Het
Lamb3 A G 1: 193,013,067 (GRCm39) probably null Het
Lingo2 A G 4: 35,708,315 (GRCm39) V555A probably damaging Het
Mbd5 T C 2: 49,162,946 (GRCm39) S251P probably damaging Het
Mc4r T C 18: 66,992,766 (GRCm39) S116G probably benign Het
Mipol1 T C 12: 57,352,874 (GRCm39) V71A possibly damaging Het
Myo15b A C 11: 115,757,461 (GRCm39) S1104R probably benign Het
Nek1 T A 8: 61,459,771 (GRCm39) D26E probably damaging Het
Neu1 C T 17: 35,151,089 (GRCm39) probably benign Het
Npffr2 T C 5: 89,730,975 (GRCm39) S302P possibly damaging Het
Or8b48 T C 9: 38,492,675 (GRCm39) M34T probably benign Het
Palmd T A 3: 116,741,689 (GRCm39) probably benign Het
Pcdh8 A T 14: 80,008,047 (GRCm39) V172E probably benign Het
Pnpla6 C A 8: 3,572,403 (GRCm39) Q291K probably damaging Het
Pou2af2 T A 9: 51,202,870 (GRCm39) S95C probably damaging Het
Prkch T C 12: 73,749,320 (GRCm39) F357L probably benign Het
Ptprj A T 2: 90,301,497 (GRCm39) Y212N probably damaging Het
Reln G T 5: 22,165,376 (GRCm39) H2061N probably benign Het
Rint1 T A 5: 24,005,656 (GRCm39) S113T probably benign Het
Rnf38 G C 4: 44,142,468 (GRCm39) probably null Het
Slc30a4 T A 2: 122,527,936 (GRCm39) I374L probably benign Het
Slfn10-ps T C 11: 82,920,676 (GRCm39) noncoding transcript Het
Smcp A T 3: 92,491,710 (GRCm39) C46S unknown Het
Smu1 A C 4: 40,748,570 (GRCm39) V240G probably damaging Het
Srsf5 A G 12: 80,996,519 (GRCm39) probably benign Het
Stn1 T C 19: 47,524,812 (GRCm39) probably null Het
Stx18 A G 5: 38,262,335 (GRCm39) E63G probably damaging Het
Tas2r130 A G 6: 131,607,130 (GRCm39) Y222H probably benign Het
Tescl G T 7: 24,032,758 (GRCm39) P189Q probably benign Het
Tlr1 A G 5: 65,084,203 (GRCm39) S125P probably damaging Het
Ugt2a2 G T 5: 87,609,880 (GRCm39) D566E possibly damaging Het
Unc13b A T 4: 43,237,144 (GRCm39) T3405S probably damaging Het
Upf1 G A 8: 70,785,709 (GRCm39) Q1046* probably null Het
Wwox T A 8: 115,172,090 (GRCm39) Y61* probably null Het
Zfhx4 C T 3: 5,468,170 (GRCm39) T2776M probably damaging Het
Zranb3 G A 1: 127,888,488 (GRCm39) probably benign Het
Other mutations in Il1rap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Il1rap APN 16 26,541,151 (GRCm39) missense possibly damaging 0.77
IGL00976:Il1rap APN 16 26,517,589 (GRCm39) missense probably benign 0.09
IGL01075:Il1rap APN 16 26,498,987 (GRCm39) missense possibly damaging 0.94
IGL01665:Il1rap APN 16 26,541,463 (GRCm39) missense probably damaging 1.00
IGL01962:Il1rap APN 16 26,529,318 (GRCm39) nonsense probably null
IGL02101:Il1rap APN 16 26,442,932 (GRCm39) missense possibly damaging 0.61
IGL02411:Il1rap APN 16 26,529,366 (GRCm39) missense probably damaging 1.00
IGL03132:Il1rap APN 16 26,498,869 (GRCm39) missense probably damaging 1.00
bacchus UTSW 16 26,529,382 (GRCm39) critical splice donor site probably null
I1329:Il1rap UTSW 16 26,511,600 (GRCm39) missense probably benign 0.07
LCD18:Il1rap UTSW 16 26,450,343 (GRCm39) intron probably benign
PIT1430001:Il1rap UTSW 16 26,529,343 (GRCm39) missense possibly damaging 0.53
R0302:Il1rap UTSW 16 26,511,544 (GRCm39) missense probably benign 0.02
R0454:Il1rap UTSW 16 26,517,625 (GRCm39) missense probably damaging 1.00
R0481:Il1rap UTSW 16 26,511,585 (GRCm39) missense probably damaging 1.00
R0612:Il1rap UTSW 16 26,519,855 (GRCm39) missense possibly damaging 0.48
R0765:Il1rap UTSW 16 26,529,382 (GRCm39) critical splice donor site probably null
R1801:Il1rap UTSW 16 26,517,625 (GRCm39) missense probably damaging 1.00
R1867:Il1rap UTSW 16 26,541,676 (GRCm39) missense probably damaging 1.00
R1942:Il1rap UTSW 16 26,541,205 (GRCm39) missense probably damaging 1.00
R1996:Il1rap UTSW 16 26,541,243 (GRCm39) missense probably benign 0.06
R2118:Il1rap UTSW 16 26,529,315 (GRCm39) missense probably damaging 1.00
R2122:Il1rap UTSW 16 26,529,315 (GRCm39) missense probably damaging 1.00
R2124:Il1rap UTSW 16 26,529,315 (GRCm39) missense probably damaging 1.00
R3104:Il1rap UTSW 16 26,541,502 (GRCm39) missense probably benign 0.01
R3105:Il1rap UTSW 16 26,541,502 (GRCm39) missense probably benign 0.01
R3106:Il1rap UTSW 16 26,541,502 (GRCm39) missense probably benign 0.01
R3891:Il1rap UTSW 16 26,495,606 (GRCm39) missense probably damaging 1.00
R4133:Il1rap UTSW 16 26,541,636 (GRCm39) missense probably benign 0.34
R4409:Il1rap UTSW 16 26,531,015 (GRCm39) splice site probably null
R4610:Il1rap UTSW 16 26,533,526 (GRCm39) missense probably benign 0.11
R4755:Il1rap UTSW 16 26,541,532 (GRCm39) missense probably benign 0.20
R4776:Il1rap UTSW 16 26,511,549 (GRCm39) missense possibly damaging 0.57
R4793:Il1rap UTSW 16 26,513,984 (GRCm39) missense probably benign 0.09
R4811:Il1rap UTSW 16 26,519,988 (GRCm39) critical splice donor site probably null
R4834:Il1rap UTSW 16 26,495,685 (GRCm39) missense probably damaging 1.00
R5119:Il1rap UTSW 16 26,442,949 (GRCm39) missense probably benign 0.01
R5744:Il1rap UTSW 16 26,498,974 (GRCm39) missense probably benign 0.01
R6108:Il1rap UTSW 16 26,541,457 (GRCm39) missense probably damaging 1.00
R6149:Il1rap UTSW 16 26,530,969 (GRCm39) missense probably damaging 1.00
R6233:Il1rap UTSW 16 26,529,256 (GRCm39) missense probably benign 0.24
R6246:Il1rap UTSW 16 26,533,631 (GRCm39) missense probably benign
R6249:Il1rap UTSW 16 26,511,598 (GRCm39) missense possibly damaging 0.88
R6254:Il1rap UTSW 16 26,514,020 (GRCm39) missense probably benign
R6748:Il1rap UTSW 16 26,541,106 (GRCm39) missense probably benign 0.02
R7151:Il1rap UTSW 16 26,530,878 (GRCm39) missense probably damaging 1.00
R7794:Il1rap UTSW 16 26,541,658 (GRCm39) missense probably benign
R7818:Il1rap UTSW 16 26,517,597 (GRCm39) missense probably damaging 1.00
R7819:Il1rap UTSW 16 26,541,151 (GRCm39) missense possibly damaging 0.77
R7863:Il1rap UTSW 16 26,495,461 (GRCm39) missense probably damaging 1.00
R8240:Il1rap UTSW 16 26,520,001 (GRCm39) missense probably benign
R8559:Il1rap UTSW 16 26,530,884 (GRCm39) missense probably benign 0.29
R8934:Il1rap UTSW 16 26,495,734 (GRCm39) missense probably damaging 1.00
R8986:Il1rap UTSW 16 26,533,696 (GRCm39) missense probably damaging 1.00
R9261:Il1rap UTSW 16 26,541,724 (GRCm39) missense possibly damaging 0.83
R9286:Il1rap UTSW 16 26,517,604 (GRCm39) missense possibly damaging 0.89
R9326:Il1rap UTSW 16 26,495,641 (GRCm39) missense probably damaging 1.00
R9408:Il1rap UTSW 16 26,533,675 (GRCm39) missense possibly damaging 0.91
R9493:Il1rap UTSW 16 26,541,702 (GRCm39) missense probably benign 0.00
R9723:Il1rap UTSW 16 26,442,907 (GRCm39) start codon destroyed probably null 0.97
X0027:Il1rap UTSW 16 26,519,897 (GRCm39) missense probably benign 0.20
X0028:Il1rap UTSW 16 26,495,714 (GRCm39) missense probably damaging 1.00
Z1176:Il1rap UTSW 16 26,541,149 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCGTCTTTTGTGGACAGGACAAC -3'
(R):5'- GAGAAGAACAGCTCTCATTCCAGCC -3'

Sequencing Primer
(F):5'- TTTTGTGGACAGGACAACTACCAG -3'
(R):5'- TTCCAGAACTTGGAGCCAGAATG -3'
Posted On 2014-04-13