Incidental Mutation 'R1552:Uhrf1bp1'
ID170042
Institutional Source Beutler Lab
Gene Symbol Uhrf1bp1
Ensembl Gene ENSMUSG00000039512
Gene NameUHRF1 (ICBP90) binding protein 1
Synonyms1110020K19Rik, F830021D11Rik
MMRRC Submission 039591-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1552 (G1)
Quality Score204
Status Validated
Chromosome17
Chromosomal Location27856490-27900040 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 27890071 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 1088 (F1088S)
Ref Sequence ENSEMBL: ENSMUSP00000110499 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114849]
Predicted Effect possibly damaging
Transcript: ENSMUST00000114849
AA Change: F1088S

PolyPhen 2 Score 0.871 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000110499
Gene: ENSMUSG00000039512
AA Change: F1088S

DomainStartEndE-ValueType
Pfam:Chorein_N 1 104 2.6e-18 PFAM
low complexity region 234 247 N/A INTRINSIC
low complexity region 297 306 N/A INTRINSIC
low complexity region 1128 1144 N/A INTRINSIC
low complexity region 1200 1216 N/A INTRINSIC
low complexity region 1322 1333 N/A INTRINSIC
low complexity region 1375 1386 N/A INTRINSIC
coiled coil region 1394 1424 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137825
Meta Mutation Damage Score 0.1269 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.7%
Validation Efficiency 97% (71/73)
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810046K07Rik T A 9: 51,291,570 S95C probably damaging Het
Abcc5 T A 16: 20,398,867 I365F probably damaging Het
Abhd15 T C 11: 77,515,407 L70P probably damaging Het
Adam18 A C 8: 24,646,361 H381Q probably benign Het
Ankfy1 T C 11: 72,754,495 probably null Het
Arcn1 C T 9: 44,758,994 A112T probably damaging Het
Calhm1 C T 19: 47,141,201 R294H probably benign Het
Ccdc121 A G 1: 181,510,991 L132P probably damaging Het
Cdk5rap1 T C 2: 154,370,695 E81G probably benign Het
Cep170 T C 1: 176,782,494 probably benign Het
Cep350 C T 1: 155,910,738 R1454Q possibly damaging Het
Chrna3 C A 9: 55,015,908 E205D probably benign Het
Chst5 T C 8: 111,890,280 D236G probably damaging Het
Coro1a T C 7: 126,699,952 N367D probably benign Het
Cyp3a16 T C 5: 145,436,536 I474V probably benign Het
Cyth3 G A 5: 143,697,750 V87I probably benign Het
Dclk3 C A 9: 111,488,579 T761K probably damaging Het
Dvl2 T A 11: 70,006,372 M300K possibly damaging Het
Eefsec C T 6: 88,376,200 probably benign Het
Exog T C 9: 119,445,110 S54P unknown Het
Fasn A G 11: 120,818,558 S519P probably damaging Het
Gas8 G A 8: 123,520,646 A16T probably benign Het
Got2 A G 8: 95,869,494 S333P probably benign Het
Hadhb T A 5: 30,176,933 L287Q probably null Het
Ift57 A G 16: 49,759,353 T211A probably benign Het
Il1rap A G 16: 26,722,434 E475G possibly damaging Het
Ilkap A T 1: 91,384,594 D11E probably damaging Het
Impact T C 18: 12,984,280 S137P probably benign Het
Jarid2 T C 13: 44,911,199 V920A probably damaging Het
Kcnk18 A T 19: 59,235,458 H345L probably damaging Het
Kdm4d A T 9: 14,464,029 Y178N probably damaging Het
Klk1b1 A G 7: 43,969,343 Y48C probably damaging Het
Klra5 G T 6: 129,909,885 T60K probably damaging Het
Kng2 A T 16: 22,987,520 L643H probably damaging Het
Lamb3 A G 1: 193,330,759 probably null Het
Lingo2 A G 4: 35,708,315 V555A probably damaging Het
Mbd5 T C 2: 49,272,934 S251P probably damaging Het
Mc4r T C 18: 66,859,695 S116G probably benign Het
Mipol1 T C 12: 57,306,088 V71A possibly damaging Het
Myo15b A C 11: 115,866,635 S1104R probably benign Het
Nek1 T A 8: 61,006,737 D26E probably damaging Het
Neu1 C T 17: 34,932,113 probably benign Het
Npffr2 T C 5: 89,583,116 S302P possibly damaging Het
Olfr912 T C 9: 38,581,379 M34T probably benign Het
Palmd T A 3: 116,948,040 probably benign Het
Pcdh8 A T 14: 79,770,607 V172E probably benign Het
Pnpla6 C A 8: 3,522,403 Q291K probably damaging Het
Prkch T C 12: 73,702,546 F357L probably benign Het
Ptprj A T 2: 90,471,153 Y212N probably damaging Het
Reln G T 5: 21,960,378 H2061N probably benign Het
Rint1 T A 5: 23,800,658 S113T probably benign Het
Rnf38 G C 4: 44,142,468 probably null Het
Slc30a4 T A 2: 122,686,016 I374L probably benign Het
Slfn10-ps T C 11: 83,029,850 noncoding transcript Het
Smcp A T 3: 92,584,403 C46S unknown Het
Smu1 A C 4: 40,748,570 V240G probably damaging Het
Srsf5 A G 12: 80,949,745 probably benign Het
Stn1 T C 19: 47,536,373 probably null Het
Stx18 A G 5: 38,104,991 E63G probably damaging Het
Tas2r130 A G 6: 131,630,167 Y222H probably benign Het
Tescl G T 7: 24,333,333 P189Q probably benign Het
Tlr1 A G 5: 64,926,860 S125P probably damaging Het
Ugt2a2 G T 5: 87,462,021 D566E possibly damaging Het
Unc13b A T 4: 43,237,144 T3405S probably damaging Het
Upf1 G A 8: 70,333,059 Q1046* probably null Het
Wwox T A 8: 114,445,350 Y61* probably null Het
Zfhx4 C T 3: 5,403,110 T2776M probably damaging Het
Zranb3 G A 1: 127,960,751 probably benign Het
Other mutations in Uhrf1bp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00675:Uhrf1bp1 APN 17 27876917 splice site probably benign
IGL00786:Uhrf1bp1 APN 17 27879292 missense probably damaging 0.99
IGL01074:Uhrf1bp1 APN 17 27879291 missense possibly damaging 0.94
IGL01780:Uhrf1bp1 APN 17 27893500 missense probably damaging 1.00
IGL02668:Uhrf1bp1 APN 17 27886575 missense possibly damaging 0.53
IGL02686:Uhrf1bp1 APN 17 27894589 missense probably benign
IGL03240:Uhrf1bp1 APN 17 27893253 missense probably benign 0.37
hades UTSW 17 27894746 missense probably damaging 1.00
R0167:Uhrf1bp1 UTSW 17 27880202 missense possibly damaging 0.46
R0240:Uhrf1bp1 UTSW 17 27895870 splice site probably benign
R0332:Uhrf1bp1 UTSW 17 27893294 critical splice donor site probably null
R0668:Uhrf1bp1 UTSW 17 27895939 missense probably benign 0.16
R0726:Uhrf1bp1 UTSW 17 27885489 missense possibly damaging 0.50
R0964:Uhrf1bp1 UTSW 17 27887178 missense probably damaging 0.96
R1125:Uhrf1bp1 UTSW 17 27893449 missense probably damaging 1.00
R1139:Uhrf1bp1 UTSW 17 27890071 missense possibly damaging 0.87
R1164:Uhrf1bp1 UTSW 17 27895380 critical splice donor site probably null
R1192:Uhrf1bp1 UTSW 17 27890071 missense possibly damaging 0.87
R1277:Uhrf1bp1 UTSW 17 27890071 missense possibly damaging 0.87
R1279:Uhrf1bp1 UTSW 17 27890071 missense possibly damaging 0.87
R1340:Uhrf1bp1 UTSW 17 27894721 missense probably benign 0.00
R1341:Uhrf1bp1 UTSW 17 27877419 splice site probably benign
R1344:Uhrf1bp1 UTSW 17 27894577 missense probably benign 0.41
R1418:Uhrf1bp1 UTSW 17 27894577 missense probably benign 0.41
R1726:Uhrf1bp1 UTSW 17 27886251 splice site probably null
R1791:Uhrf1bp1 UTSW 17 27894746 missense probably damaging 1.00
R1796:Uhrf1bp1 UTSW 17 27890071 missense possibly damaging 0.87
R2858:Uhrf1bp1 UTSW 17 27885462 missense probably damaging 0.99
R3034:Uhrf1bp1 UTSW 17 27894746 missense probably damaging 1.00
R4111:Uhrf1bp1 UTSW 17 27886090 nonsense probably null
R4159:Uhrf1bp1 UTSW 17 27884087 missense probably damaging 1.00
R4160:Uhrf1bp1 UTSW 17 27884087 missense probably damaging 1.00
R4161:Uhrf1bp1 UTSW 17 27884087 missense probably damaging 1.00
R4431:Uhrf1bp1 UTSW 17 27885931 missense probably damaging 1.00
R4575:Uhrf1bp1 UTSW 17 27887503 missense probably benign 0.02
R4657:Uhrf1bp1 UTSW 17 27890105 missense probably benign 0.09
R4666:Uhrf1bp1 UTSW 17 27893503 missense possibly damaging 0.95
R4825:Uhrf1bp1 UTSW 17 27877394 missense probably damaging 0.98
R4872:Uhrf1bp1 UTSW 17 27890136 missense probably benign 0.10
R4956:Uhrf1bp1 UTSW 17 27889984 splice site probably null
R4976:Uhrf1bp1 UTSW 17 27884026 missense probably damaging 0.99
R4982:Uhrf1bp1 UTSW 17 27886606 missense probably benign 0.05
R5017:Uhrf1bp1 UTSW 17 27894739 nonsense probably null
R5033:Uhrf1bp1 UTSW 17 27886864 missense probably damaging 0.99
R5137:Uhrf1bp1 UTSW 17 27876990 splice site probably null
R5159:Uhrf1bp1 UTSW 17 27881556 missense probably damaging 0.98
R5177:Uhrf1bp1 UTSW 17 27885018 missense possibly damaging 0.94
R5196:Uhrf1bp1 UTSW 17 27856763 missense probably benign 0.09
R5214:Uhrf1bp1 UTSW 17 27887515 missense probably benign
R5352:Uhrf1bp1 UTSW 17 27887515 missense probably benign
R5354:Uhrf1bp1 UTSW 17 27887515 missense probably benign
R5425:Uhrf1bp1 UTSW 17 27887515 missense probably benign
R5601:Uhrf1bp1 UTSW 17 27884494 missense probably damaging 1.00
R6080:Uhrf1bp1 UTSW 17 27880297 missense probably benign
R6088:Uhrf1bp1 UTSW 17 27884605 critical splice donor site probably null
R6331:Uhrf1bp1 UTSW 17 27893201 missense probably benign 0.01
R6529:Uhrf1bp1 UTSW 17 27879776 missense possibly damaging 0.90
R6614:Uhrf1bp1 UTSW 17 27876925 missense probably benign 0.18
R6701:Uhrf1bp1 UTSW 17 27887357 nonsense probably null
R7082:Uhrf1bp1 UTSW 17 27890065 missense probably damaging 1.00
R7158:Uhrf1bp1 UTSW 17 27886433 nonsense probably null
R8338:Uhrf1bp1 UTSW 17 27876695 missense probably damaging 1.00
RF005:Uhrf1bp1 UTSW 17 27885531 missense probably damaging 1.00
X0017:Uhrf1bp1 UTSW 17 27877341 missense probably benign 0.03
Z1176:Uhrf1bp1 UTSW 17 27876676 missense probably damaging 1.00
Z1176:Uhrf1bp1 UTSW 17 27886306 missense probably damaging 1.00
Z1177:Uhrf1bp1 UTSW 17 27884966 missense not run
Predicted Primers PCR Primer
(F):5'- TTACCTGTCAGAACTGGGGAAGCG -3'
(R):5'- GGTGACCTTGTAGCCTTAAGACCAC -3'

Sequencing Primer
(F):5'- CGGATCAGCCTGAGGATG -3'
(R):5'- acgggagtgtgtggtgg -3'
Posted On2014-04-13