Incidental Mutation 'R1552:Neu1'
ID170043
Institutional Source Beutler Lab
Gene Symbol Neu1
Ensembl Gene ENSMUSG00000007038
Gene Nameneuraminidase 1
SynonymsApl, Neu-1, sialidase 1, lysosomal sialidase, G9, Map-2, Bat-7, Bat7, Aglp
MMRRC Submission 039591-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1552 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location34931253-34935953 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to T at 34932113 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000132965 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007249] [ENSMUST00000007253] [ENSMUST00000169230]
Predicted Effect probably benign
Transcript: ENSMUST00000007249
SMART Domains Protein: ENSMUSP00000007249
Gene: ENSMUSG00000007034

DomainStartEndE-ValueType
transmembrane domain 34 56 N/A INTRINSIC
low complexity region 93 102 N/A INTRINSIC
transmembrane domain 226 248 N/A INTRINSIC
transmembrane domain 250 272 N/A INTRINSIC
Pfam:Choline_transpo 311 674 5.4e-119 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000007253
SMART Domains Protein: ENSMUSP00000007253
Gene: ENSMUSG00000007038

DomainStartEndE-ValueType
signal peptide 1 41 N/A INTRINSIC
Pfam:BNR_3 74 249 1e-16 PFAM
Pfam:BNR_2 82 377 1.8e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169230
SMART Domains Protein: ENSMUSP00000132965
Gene: ENSMUSG00000007034

DomainStartEndE-ValueType
transmembrane domain 74 96 N/A INTRINSIC
transmembrane domain 98 120 N/A INTRINSIC
Pfam:Choline_transpo 157 524 3.9e-129 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173269
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173664
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174715
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.7%
Validation Efficiency 97% (71/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a lysosomal enzyme that cleaves terminal sialic acid residues from substrates such as glycoproteins and glycolipids. In the lysosome, this enzyme is part of a heterotrimeric complex together with beta-galactosidase and cathepsin A (the latter is also referred to as 'protective protein'). Mutations in this gene can lead to sialidosis, a lysosomal storage disease that can be type 1 (cherry red spot-myoclonus syndrome or normosomatic type), which is late-onset, or type 2 (the dysmorphic type), which occurs at an earlier age with increased severity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Nullizygous mice develop features of early-onset lysosomal storage disease (sialidosis), including severe nephropathy, edema, splenomegaly, kyphosis and oligosacchariduria, and display myoclonus, lordosis, extramedullary hematopoiesis, dyspnea, weight loss, gait defects, tremors and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810046K07Rik T A 9: 51,291,570 S95C probably damaging Het
Abcc5 T A 16: 20,398,867 I365F probably damaging Het
Abhd15 T C 11: 77,515,407 L70P probably damaging Het
Adam18 A C 8: 24,646,361 H381Q probably benign Het
Ankfy1 T C 11: 72,754,495 probably null Het
Arcn1 C T 9: 44,758,994 A112T probably damaging Het
Calhm1 C T 19: 47,141,201 R294H probably benign Het
Ccdc121 A G 1: 181,510,991 L132P probably damaging Het
Cdk5rap1 T C 2: 154,370,695 E81G probably benign Het
Cep170 T C 1: 176,782,494 probably benign Het
Cep350 C T 1: 155,910,738 R1454Q possibly damaging Het
Chrna3 C A 9: 55,015,908 E205D probably benign Het
Chst5 T C 8: 111,890,280 D236G probably damaging Het
Coro1a T C 7: 126,699,952 N367D probably benign Het
Cyp3a16 T C 5: 145,436,536 I474V probably benign Het
Cyth3 G A 5: 143,697,750 V87I probably benign Het
Dclk3 C A 9: 111,488,579 T761K probably damaging Het
Dvl2 T A 11: 70,006,372 M300K possibly damaging Het
Eefsec C T 6: 88,376,200 probably benign Het
Exog T C 9: 119,445,110 S54P unknown Het
Fasn A G 11: 120,818,558 S519P probably damaging Het
Gas8 G A 8: 123,520,646 A16T probably benign Het
Got2 A G 8: 95,869,494 S333P probably benign Het
Hadhb T A 5: 30,176,933 L287Q probably null Het
Ift57 A G 16: 49,759,353 T211A probably benign Het
Il1rap A G 16: 26,722,434 E475G possibly damaging Het
Ilkap A T 1: 91,384,594 D11E probably damaging Het
Impact T C 18: 12,984,280 S137P probably benign Het
Jarid2 T C 13: 44,911,199 V920A probably damaging Het
Kcnk18 A T 19: 59,235,458 H345L probably damaging Het
Kdm4d A T 9: 14,464,029 Y178N probably damaging Het
Klk1b1 A G 7: 43,969,343 Y48C probably damaging Het
Klra5 G T 6: 129,909,885 T60K probably damaging Het
Kng2 A T 16: 22,987,520 L643H probably damaging Het
Lamb3 A G 1: 193,330,759 probably null Het
Lingo2 A G 4: 35,708,315 V555A probably damaging Het
Mbd5 T C 2: 49,272,934 S251P probably damaging Het
Mc4r T C 18: 66,859,695 S116G probably benign Het
Mipol1 T C 12: 57,306,088 V71A possibly damaging Het
Myo15b A C 11: 115,866,635 S1104R probably benign Het
Nek1 T A 8: 61,006,737 D26E probably damaging Het
Npffr2 T C 5: 89,583,116 S302P possibly damaging Het
Olfr912 T C 9: 38,581,379 M34T probably benign Het
Palmd T A 3: 116,948,040 probably benign Het
Pcdh8 A T 14: 79,770,607 V172E probably benign Het
Pnpla6 C A 8: 3,522,403 Q291K probably damaging Het
Prkch T C 12: 73,702,546 F357L probably benign Het
Ptprj A T 2: 90,471,153 Y212N probably damaging Het
Reln G T 5: 21,960,378 H2061N probably benign Het
Rint1 T A 5: 23,800,658 S113T probably benign Het
Rnf38 G C 4: 44,142,468 probably null Het
Slc30a4 T A 2: 122,686,016 I374L probably benign Het
Slfn10-ps T C 11: 83,029,850 noncoding transcript Het
Smcp A T 3: 92,584,403 C46S unknown Het
Smu1 A C 4: 40,748,570 V240G probably damaging Het
Srsf5 A G 12: 80,949,745 probably benign Het
Stn1 T C 19: 47,536,373 probably null Het
Stx18 A G 5: 38,104,991 E63G probably damaging Het
Tas2r130 A G 6: 131,630,167 Y222H probably benign Het
Tescl G T 7: 24,333,333 P189Q probably benign Het
Tlr1 A G 5: 64,926,860 S125P probably damaging Het
Ugt2a2 G T 5: 87,462,021 D566E possibly damaging Het
Uhrf1bp1 T C 17: 27,890,071 F1088S possibly damaging Het
Unc13b A T 4: 43,237,144 T3405S probably damaging Het
Upf1 G A 8: 70,333,059 Q1046* probably null Het
Wwox T A 8: 114,445,350 Y61* probably null Het
Zfhx4 C T 3: 5,403,110 T2776M probably damaging Het
Zranb3 G A 1: 127,960,751 probably benign Het
Other mutations in Neu1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01607:Neu1 APN 17 34934716 missense probably benign 0.34
IGL02197:Neu1 APN 17 34934665 missense possibly damaging 0.92
IGL02442:Neu1 APN 17 34934469 missense probably benign
IGL02545:Neu1 APN 17 34931501 missense probably benign 0.41
FR4340:Neu1 UTSW 17 34932558 unclassified probably benign
R0331:Neu1 UTSW 17 34934170 missense possibly damaging 0.62
R0508:Neu1 UTSW 17 34932784 missense probably benign 0.07
R0646:Neu1 UTSW 17 34934760 missense probably damaging 1.00
R0683:Neu1 UTSW 17 34934325 splice site probably null
R1300:Neu1 UTSW 17 34934338 missense possibly damaging 0.87
R1545:Neu1 UTSW 17 34934398 missense probably benign 0.00
R2107:Neu1 UTSW 17 34934398 missense probably benign 0.00
R2108:Neu1 UTSW 17 34934398 missense probably benign 0.00
R2279:Neu1 UTSW 17 34934374 missense probably damaging 1.00
R2291:Neu1 UTSW 17 34932766 missense probably damaging 1.00
R2895:Neu1 UTSW 17 34932782 missense probably benign 0.08
R4747:Neu1 UTSW 17 34934383 missense possibly damaging 0.77
R6010:Neu1 UTSW 17 34932055 missense probably damaging 1.00
R6122:Neu1 UTSW 17 34934754 missense probably benign 0.00
R8490:Neu1 UTSW 17 34932006 missense probably benign 0.00
RF034:Neu1 UTSW 17 34932558 unclassified probably benign
RF045:Neu1 UTSW 17 34932558 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- ACCTCGTGAAGCTTGTCTGCATTG -3'
(R):5'- TCTCTGGGCTGAAGTCATCCTCTG -3'

Sequencing Primer
(F):5'- GCATTGAGGTGTCCTTCTGC -3'
(R):5'- GAAGTCATCCTCTGCCCTGG -3'
Posted On2014-04-13