Incidental Mutation 'R1552:Impact'
ID170044
Institutional Source Beutler Lab
Gene Symbol Impact
Ensembl Gene ENSMUSG00000024423
Gene Nameimpact, RWD domain protein
SynonymsE430016J11Rik
MMRRC Submission 039591-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.342) question?
Stock #R1552 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location12972252-12992948 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 12984280 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 137 (S137P)
Ref Sequence ENSEMBL: ENSMUSP00000025290 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025290]
Predicted Effect probably benign
Transcript: ENSMUST00000025290
AA Change: S137P

PolyPhen 2 Score 0.252 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000025290
Gene: ENSMUSG00000024423
AA Change: S137P

DomainStartEndE-ValueType
RWD 14 116 7.86e-29 SMART
low complexity region 126 139 N/A INTRINSIC
low complexity region 160 171 N/A INTRINSIC
Pfam:UPF0029 180 288 8.5e-36 PFAM
low complexity region 306 315 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.7%
Validation Efficiency 97% (71/73)
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810046K07Rik T A 9: 51,291,570 S95C probably damaging Het
Abcc5 T A 16: 20,398,867 I365F probably damaging Het
Abhd15 T C 11: 77,515,407 L70P probably damaging Het
Adam18 A C 8: 24,646,361 H381Q probably benign Het
Ankfy1 T C 11: 72,754,495 probably null Het
Arcn1 C T 9: 44,758,994 A112T probably damaging Het
Calhm1 C T 19: 47,141,201 R294H probably benign Het
Ccdc121 A G 1: 181,510,991 L132P probably damaging Het
Cdk5rap1 T C 2: 154,370,695 E81G probably benign Het
Cep170 T C 1: 176,782,494 probably benign Het
Cep350 C T 1: 155,910,738 R1454Q possibly damaging Het
Chrna3 C A 9: 55,015,908 E205D probably benign Het
Chst5 T C 8: 111,890,280 D236G probably damaging Het
Coro1a T C 7: 126,699,952 N367D probably benign Het
Cyp3a16 T C 5: 145,436,536 I474V probably benign Het
Cyth3 G A 5: 143,697,750 V87I probably benign Het
Dclk3 C A 9: 111,488,579 T761K probably damaging Het
Dvl2 T A 11: 70,006,372 M300K possibly damaging Het
Eefsec C T 6: 88,376,200 probably benign Het
Exog T C 9: 119,445,110 S54P unknown Het
Fasn A G 11: 120,818,558 S519P probably damaging Het
Gas8 G A 8: 123,520,646 A16T probably benign Het
Got2 A G 8: 95,869,494 S333P probably benign Het
Hadhb T A 5: 30,176,933 L287Q probably null Het
Ift57 A G 16: 49,759,353 T211A probably benign Het
Il1rap A G 16: 26,722,434 E475G possibly damaging Het
Ilkap A T 1: 91,384,594 D11E probably damaging Het
Jarid2 T C 13: 44,911,199 V920A probably damaging Het
Kcnk18 A T 19: 59,235,458 H345L probably damaging Het
Kdm4d A T 9: 14,464,029 Y178N probably damaging Het
Klk1b1 A G 7: 43,969,343 Y48C probably damaging Het
Klra5 G T 6: 129,909,885 T60K probably damaging Het
Kng2 A T 16: 22,987,520 L643H probably damaging Het
Lamb3 A G 1: 193,330,759 probably null Het
Lingo2 A G 4: 35,708,315 V555A probably damaging Het
Mbd5 T C 2: 49,272,934 S251P probably damaging Het
Mc4r T C 18: 66,859,695 S116G probably benign Het
Mipol1 T C 12: 57,306,088 V71A possibly damaging Het
Myo15b A C 11: 115,866,635 S1104R probably benign Het
Nek1 T A 8: 61,006,737 D26E probably damaging Het
Neu1 C T 17: 34,932,113 probably benign Het
Npffr2 T C 5: 89,583,116 S302P possibly damaging Het
Olfr912 T C 9: 38,581,379 M34T probably benign Het
Palmd T A 3: 116,948,040 probably benign Het
Pcdh8 A T 14: 79,770,607 V172E probably benign Het
Pnpla6 C A 8: 3,522,403 Q291K probably damaging Het
Prkch T C 12: 73,702,546 F357L probably benign Het
Ptprj A T 2: 90,471,153 Y212N probably damaging Het
Reln G T 5: 21,960,378 H2061N probably benign Het
Rint1 T A 5: 23,800,658 S113T probably benign Het
Rnf38 G C 4: 44,142,468 probably null Het
Slc30a4 T A 2: 122,686,016 I374L probably benign Het
Slfn10-ps T C 11: 83,029,850 noncoding transcript Het
Smcp A T 3: 92,584,403 C46S unknown Het
Smu1 A C 4: 40,748,570 V240G probably damaging Het
Srsf5 A G 12: 80,949,745 probably benign Het
Stn1 T C 19: 47,536,373 probably null Het
Stx18 A G 5: 38,104,991 E63G probably damaging Het
Tas2r130 A G 6: 131,630,167 Y222H probably benign Het
Tescl G T 7: 24,333,333 P189Q probably benign Het
Tlr1 A G 5: 64,926,860 S125P probably damaging Het
Ugt2a2 G T 5: 87,462,021 D566E possibly damaging Het
Uhrf1bp1 T C 17: 27,890,071 F1088S possibly damaging Het
Unc13b A T 4: 43,237,144 T3405S probably damaging Het
Upf1 G A 8: 70,333,059 Q1046* probably null Het
Wwox T A 8: 114,445,350 Y61* probably null Het
Zfhx4 C T 3: 5,403,110 T2776M probably damaging Het
Zranb3 G A 1: 127,960,751 probably benign Het
Other mutations in Impact
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01531:Impact APN 18 12976019 missense probably benign 0.00
IGL01960:Impact APN 18 12974758 missense probably benign 0.13
R1056:Impact UTSW 18 12976524 missense probably benign 0.14
R4111:Impact UTSW 18 12976033 critical splice donor site probably null
R4734:Impact UTSW 18 12985289 missense probably damaging 1.00
R4885:Impact UTSW 18 12986373 missense probably damaging 1.00
R5566:Impact UTSW 18 12974762 missense probably damaging 0.98
R5601:Impact UTSW 18 12976007 missense probably benign 0.44
R5966:Impact UTSW 18 12990544 missense probably benign 0.00
R6974:Impact UTSW 18 12982112 missense probably damaging 1.00
R7168:Impact UTSW 18 12986313 splice site probably null
R8108:Impact UTSW 18 12984331 missense probably benign 0.00
R8460:Impact UTSW 18 12976507 missense probably benign 0.00
R8474:Impact UTSW 18 12974741 missense probably damaging 1.00
R8897:Impact UTSW 18 12990494 missense probably benign 0.10
Z1177:Impact UTSW 18 12988366 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGGGCATCTGATCCTCAACTCAC -3'
(R):5'- AACAAACGCCTCCAAACTTGTGTG -3'

Sequencing Primer
(F):5'- gaagaatggtgtgtagagatcaag -3'
(R):5'- AGAACATCAGCACCCTCTTC -3'
Posted On2014-04-13