Incidental Mutation 'R1553:Cyp2j8'
ID170067
Institutional Source Beutler Lab
Gene Symbol Cyp2j8
Ensembl Gene ENSMUSG00000082932
Gene Namecytochrome P450, family 2, subfamily j, polypeptide 8
SynonymsCyp2j8-ps, OTTMUSG00000007938
MMRRC Submission 039592-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R1553 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location96444596-96507386 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 96475557 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 290 (Y290H)
Ref Sequence ENSEMBL: ENSMUSP00000134591 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124729]
Predicted Effect probably benign
Transcript: ENSMUST00000124729
AA Change: Y290H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000134591
Gene: ENSMUSG00000082932
AA Change: Y290H

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:p450 44 500 1.2e-134 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 92.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb8 G T 5: 24,408,750 A649S probably damaging Het
Adam6a T A 12: 113,545,215 C403S probably damaging Het
Adgrg3 T C 8: 95,040,268 F417S possibly damaging Het
Ago1 T C 4: 126,440,401 E439G probably damaging Het
Alox15 A G 11: 70,349,632 V241A possibly damaging Het
Arhgap6 A G X: 169,265,484 H566R probably damaging Het
Asap1 A T 15: 64,152,852 F345I probably benign Het
Atp1b2 A G 11: 69,602,852 Y134H probably damaging Het
Atp8b3 G A 10: 80,532,542 T199M probably damaging Het
Calb1 A T 4: 15,895,656 S115C probably damaging Het
Ccdc68 A T 18: 69,940,121 I47F probably damaging Het
Cdc42bpa A T 1: 180,093,975 N560I probably benign Het
Cdhr3 T C 12: 33,042,371 D747G probably benign Het
Cdk5rap1 T G 2: 154,352,251 N378T probably damaging Het
Chil4 T G 3: 106,203,690 N296T probably benign Het
Cryaa G A 17: 31,679,559 V87I probably damaging Het
Csk G A 9: 57,630,942 L28F probably damaging Het
Cspp1 A G 1: 10,085,897 N444D possibly damaging Het
Eps8l1 A T 7: 4,477,449 D563V probably damaging Het
Fam111a A T 19: 12,587,318 S144C possibly damaging Het
Fam135a A T 1: 24,021,870 S1145R probably damaging Het
Fpr2 T A 17: 17,893,594 V284D possibly damaging Het
Furin A G 7: 80,398,592 probably null Het
Gatd1 T C 7: 141,409,893 T135A probably benign Het
Gdf3 A G 6: 122,609,765 S68P probably benign Het
Gm6871 T C 7: 41,546,398 H305R probably benign Het
Grip1 A G 10: 120,054,851 S917G probably damaging Het
Hdac10 T A 15: 89,125,515 E388V possibly damaging Het
Hectd1 T C 12: 51,773,878 N1176S probably damaging Het
Hectd4 A G 5: 121,349,259 D3439G probably benign Het
Kcna4 T C 2: 107,296,687 Y589H probably benign Het
Kcnk5 A T 14: 20,142,394 L233Q probably damaging Het
Kcnt1 T C 2: 25,900,385 I453T probably damaging Het
Kifc3 A G 8: 95,106,542 I440T possibly damaging Het
Krt10 C A 11: 99,385,980 G40* probably null Het
Lce1i A T 3: 92,777,795 C25S unknown Het
Met A G 6: 17,491,461 N74S probably benign Het
Naa35 G A 13: 59,618,279 probably null Het
Naalad2 T C 9: 18,378,669 N221S probably benign Het
Nolc1 AGCG AGCGGCG 19: 46,081,375 probably benign Het
Nsmf T C 2: 25,060,259 V181A probably damaging Het
Nwd2 T A 5: 63,800,505 S393T probably benign Het
Olfr530 T A 7: 140,373,038 T191S probably damaging Het
Olfr575 T A 7: 102,955,218 I128L possibly damaging Het
Olfr709-ps1 A T 7: 106,926,994 V155E possibly damaging Het
Papola T A 12: 105,820,410 S453R probably benign Het
Paqr9 A G 9: 95,560,209 N84S probably damaging Het
Pde5a T C 3: 122,778,936 V290A probably benign Het
Prf1 T C 10: 61,303,169 V302A probably damaging Het
Psg18 T C 7: 18,353,481 Y84C probably benign Het
Rasgrf2 C T 13: 91,890,664 R1021H probably damaging Het
Rnf114 G T 2: 167,512,602 R201L possibly damaging Het
Rp1l1 A G 14: 64,031,894 E1643G probably benign Het
Scg3 T A 9: 75,669,304 E263V probably null Het
Scn2a C T 2: 65,713,836 R854* probably null Het
Setdb2 T C 14: 59,417,485 K319E probably benign Het
Stub1 A T 17: 25,832,123 V95E probably damaging Het
Tas2r140 T A 6: 133,055,508 N96Y probably damaging Het
Tecta T A 9: 42,348,186 D1467V probably damaging Het
Tenm3 T A 8: 48,236,421 T2044S probably damaging Het
Tlr2 T A 3: 83,837,463 M438L probably benign Het
Tmem179 T C 12: 112,504,660 Y106C probably benign Het
Tspan7 A G X: 10,585,615 H187R probably benign Het
Ttn T C 2: 76,927,275 D3332G probably damaging Het
Upp2 T C 2: 58,790,140 F326S probably damaging Het
Usp2 T A 9: 44,092,155 D224E probably damaging Het
Vmn1r5 T A 6: 56,985,498 F53I probably benign Het
Wapl T A 14: 34,729,190 L727H probably damaging Het
Wipf1 T C 2: 73,437,526 D176G possibly damaging Het
Xpnpep1 G T 19: 53,006,338 D243E probably benign Het
Zfp616 A T 11: 74,083,918 I429F possibly damaging Het
Zfyve26 G A 12: 79,287,761 P161L probably benign Het
Other mutations in Cyp2j8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Cyp2j8 APN 4 96503842 missense probably benign 0.06
IGL00418:Cyp2j8 APN 4 96444616 missense possibly damaging 0.85
IGL01577:Cyp2j8 APN 4 96479071 missense probably damaging 0.96
IGL01629:Cyp2j8 APN 4 96499603 missense probably damaging 1.00
IGL01928:Cyp2j8 APN 4 96470476 splice site probably benign
IGL01978:Cyp2j8 APN 4 96504009 splice site probably null
IGL02053:Cyp2j8 APN 4 96470654 missense probably damaging 1.00
IGL02500:Cyp2j8 APN 4 96470650 missense probably damaging 1.00
IGL02947:Cyp2j8 APN 4 96470578 missense probably damaging 1.00
cyprus UTSW 4 96499603 missense probably damaging 1.00
R0558:Cyp2j8 UTSW 4 96444634 missense probably benign 0.01
R0718:Cyp2j8 UTSW 4 96501196 missense probably benign
R1557:Cyp2j8 UTSW 4 96470476 splice site probably benign
R1632:Cyp2j8 UTSW 4 96447324 missense probably benign 0.02
R1708:Cyp2j8 UTSW 4 96499595 missense probably damaging 1.00
R2119:Cyp2j8 UTSW 4 96507201 missense probably benign
R2220:Cyp2j8 UTSW 4 96444625 missense probably benign 0.03
R3123:Cyp2j8 UTSW 4 96501213 splice site probably benign
R3735:Cyp2j8 UTSW 4 96444599 missense probably damaging 1.00
R3736:Cyp2j8 UTSW 4 96444599 missense probably damaging 1.00
R4326:Cyp2j8 UTSW 4 96507329 missense probably benign 0.10
R4327:Cyp2j8 UTSW 4 96507329 missense probably benign 0.10
R4762:Cyp2j8 UTSW 4 96470649 missense probably damaging 1.00
R4901:Cyp2j8 UTSW 4 96479086 missense probably benign 0.16
R4960:Cyp2j8 UTSW 4 96507377 missense probably benign
R5260:Cyp2j8 UTSW 4 96501064 missense possibly damaging 0.65
R5562:Cyp2j8 UTSW 4 96470653 missense probably damaging 1.00
R5596:Cyp2j8 UTSW 4 96507341 missense probably benign 0.00
R5741:Cyp2j8 UTSW 4 96444643 missense probably benign 0.00
R5825:Cyp2j8 UTSW 4 96507214 missense probably benign 0.01
R5903:Cyp2j8 UTSW 4 96507277 missense possibly damaging 0.46
R6122:Cyp2j8 UTSW 4 96444640 missense probably benign
R6232:Cyp2j8 UTSW 4 96507190 missense possibly damaging 0.94
R6748:Cyp2j8 UTSW 4 96475545 missense probably benign 0.01
R6931:Cyp2j8 UTSW 4 96444781 splice site probably null
R7000:Cyp2j8 UTSW 4 96447351 missense probably benign 0.06
R7183:Cyp2j8 UTSW 4 96479181 missense probably damaging 0.97
R7186:Cyp2j8 UTSW 4 96475550 missense probably benign 0.00
R7348:Cyp2j8 UTSW 4 96444640 missense probably benign 0.00
R7575:Cyp2j8 UTSW 4 96470548 missense possibly damaging 0.63
R7648:Cyp2j8 UTSW 4 96499603 missense probably damaging 1.00
R7975:Cyp2j8 UTSW 4 96470539 missense possibly damaging 0.65
R7993:Cyp2j8 UTSW 4 96447219 critical splice donor site probably null
R8878:Cyp2j8 UTSW 4 96470570 missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- ATGCTCACCTTGCACTTCTGGATTAAC -3'
(R):5'- TCTCATTTGAAGCAGAACAGCAATACCC -3'

Sequencing Primer
(F):5'- TTAACAGTTATGTAGAGCAGAGCCC -3'
(R):5'- tctgaagagaaactgaggataagtg -3'
Posted On2014-04-13