Incidental Mutation 'R1553:Met'
ID170072
Institutional Source Beutler Lab
Gene Symbol Met
Ensembl Gene ENSMUSG00000009376
Gene Namemet proto-oncogene
SynonymsPar4, HGF receptor, c-Met
MMRRC Submission 039592-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1553 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location17463800-17573980 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 17491461 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 74 (N74S)
Ref Sequence ENSEMBL: ENSMUSP00000111103 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080469] [ENSMUST00000115442] [ENSMUST00000115443] [ENSMUST00000140070]
Predicted Effect probably benign
Transcript: ENSMUST00000080469
AA Change: N74S

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000079324
Gene: ENSMUSG00000009376
AA Change: N74S

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Sema 52 495 4.5e-134 SMART
PSI 518 561 1.18e-9 SMART
IPT 561 654 9.43e-15 SMART
IPT 655 738 4.16e-25 SMART
IPT 740 835 3.38e-16 SMART
IPT 837 933 4.08e-10 SMART
TyrKc 1076 1335 7.65e-134 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115442
AA Change: N74S

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000111102
Gene: ENSMUSG00000009376
AA Change: N74S

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Sema 52 495 4.5e-134 SMART
PSI 518 561 1.18e-9 SMART
IPT 561 654 9.43e-15 SMART
IPT 655 738 4.16e-25 SMART
IPT 740 835 3.38e-16 SMART
IPT 837 933 4.08e-10 SMART
TyrKc 1076 1335 7.65e-134 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115443
AA Change: N74S

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000111103
Gene: ENSMUSG00000009376
AA Change: N74S

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Sema 52 495 4.5e-134 SMART
PSI 518 561 1.18e-9 SMART
IPT 561 654 9.43e-15 SMART
IPT 655 738 4.16e-25 SMART
IPT 740 835 3.38e-16 SMART
IPT 837 933 4.08e-10 SMART
TyrKc 1076 1335 7.65e-134 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140070
AA Change: N74S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000117856
Gene: ENSMUSG00000009376
AA Change: N74S

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Sema 52 169 4.8e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145473
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 92.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the receptor tyrosine kinase family of proteins and the product of the proto-oncogene MET. The encoded preproprotein is proteolytically processed to generate alpha and beta subunits that are linked via disulfide bonds to form the mature receptor. Further processing of the beta subunit results in the formation of the M10 peptide, which has been shown to reduce lung fibrosis. Binding of its ligand, hepatocyte growth factor, induces dimerization and activation of the receptor, which plays a role in cellular survival, embryogenesis, and cellular migration and invasion. Mutations in this gene are associated with papillary renal cell carcinoma, hepatocellular carcinoma, and various head and neck cancers. Amplification and overexpression of this gene are also associated with multiple human cancers. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygous null mutants exhibit impaired embryonic development resulting in death. Abnormalities observed in various mutant lines include muscle agenesis due to impaired migration of myogenic precursors, defects of motor axon migration, and placental andliver defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb8 G T 5: 24,408,750 A649S probably damaging Het
Adam6a T A 12: 113,545,215 C403S probably damaging Het
Adgrg3 T C 8: 95,040,268 F417S possibly damaging Het
Ago1 T C 4: 126,440,401 E439G probably damaging Het
Alox15 A G 11: 70,349,632 V241A possibly damaging Het
Arhgap6 A G X: 169,265,484 H566R probably damaging Het
Asap1 A T 15: 64,152,852 F345I probably benign Het
Atp1b2 A G 11: 69,602,852 Y134H probably damaging Het
Atp8b3 G A 10: 80,532,542 T199M probably damaging Het
Calb1 A T 4: 15,895,656 S115C probably damaging Het
Ccdc68 A T 18: 69,940,121 I47F probably damaging Het
Cdc42bpa A T 1: 180,093,975 N560I probably benign Het
Cdhr3 T C 12: 33,042,371 D747G probably benign Het
Cdk5rap1 T G 2: 154,352,251 N378T probably damaging Het
Chil4 T G 3: 106,203,690 N296T probably benign Het
Cryaa G A 17: 31,679,559 V87I probably damaging Het
Csk G A 9: 57,630,942 L28F probably damaging Het
Cspp1 A G 1: 10,085,897 N444D possibly damaging Het
Cyp2j8 A G 4: 96,475,557 Y290H probably benign Het
Eps8l1 A T 7: 4,477,449 D563V probably damaging Het
Fam111a A T 19: 12,587,318 S144C possibly damaging Het
Fam135a A T 1: 24,021,870 S1145R probably damaging Het
Fpr2 T A 17: 17,893,594 V284D possibly damaging Het
Furin A G 7: 80,398,592 probably null Het
Gatd1 T C 7: 141,409,893 T135A probably benign Het
Gdf3 A G 6: 122,609,765 S68P probably benign Het
Gm6871 T C 7: 41,546,398 H305R probably benign Het
Grip1 A G 10: 120,054,851 S917G probably damaging Het
Hdac10 T A 15: 89,125,515 E388V possibly damaging Het
Hectd1 T C 12: 51,773,878 N1176S probably damaging Het
Hectd4 A G 5: 121,349,259 D3439G probably benign Het
Kcna4 T C 2: 107,296,687 Y589H probably benign Het
Kcnk5 A T 14: 20,142,394 L233Q probably damaging Het
Kcnt1 T C 2: 25,900,385 I453T probably damaging Het
Kifc3 A G 8: 95,106,542 I440T possibly damaging Het
Krt10 C A 11: 99,385,980 G40* probably null Het
Lce1i A T 3: 92,777,795 C25S unknown Het
Naa35 G A 13: 59,618,279 probably null Het
Naalad2 T C 9: 18,378,669 N221S probably benign Het
Nolc1 AGCG AGCGGCG 19: 46,081,375 probably benign Het
Nsmf T C 2: 25,060,259 V181A probably damaging Het
Nwd2 T A 5: 63,800,505 S393T probably benign Het
Olfr530 T A 7: 140,373,038 T191S probably damaging Het
Olfr575 T A 7: 102,955,218 I128L possibly damaging Het
Olfr709-ps1 A T 7: 106,926,994 V155E possibly damaging Het
Papola T A 12: 105,820,410 S453R probably benign Het
Paqr9 A G 9: 95,560,209 N84S probably damaging Het
Pde5a T C 3: 122,778,936 V290A probably benign Het
Prf1 T C 10: 61,303,169 V302A probably damaging Het
Psg18 T C 7: 18,353,481 Y84C probably benign Het
Rasgrf2 C T 13: 91,890,664 R1021H probably damaging Het
Rnf114 G T 2: 167,512,602 R201L possibly damaging Het
Rp1l1 A G 14: 64,031,894 E1643G probably benign Het
Scg3 T A 9: 75,669,304 E263V probably null Het
Scn2a C T 2: 65,713,836 R854* probably null Het
Setdb2 T C 14: 59,417,485 K319E probably benign Het
Stub1 A T 17: 25,832,123 V95E probably damaging Het
Tas2r140 T A 6: 133,055,508 N96Y probably damaging Het
Tecta T A 9: 42,348,186 D1467V probably damaging Het
Tenm3 T A 8: 48,236,421 T2044S probably damaging Het
Tlr2 T A 3: 83,837,463 M438L probably benign Het
Tmem179 T C 12: 112,504,660 Y106C probably benign Het
Tspan7 A G X: 10,585,615 H187R probably benign Het
Ttn T C 2: 76,927,275 D3332G probably damaging Het
Upp2 T C 2: 58,790,140 F326S probably damaging Het
Usp2 T A 9: 44,092,155 D224E probably damaging Het
Vmn1r5 T A 6: 56,985,498 F53I probably benign Het
Wapl T A 14: 34,729,190 L727H probably damaging Het
Wipf1 T C 2: 73,437,526 D176G possibly damaging Het
Xpnpep1 G T 19: 53,006,338 D243E probably benign Het
Zfp616 A T 11: 74,083,918 I429F possibly damaging Het
Zfyve26 G A 12: 79,287,761 P161L probably benign Het
Other mutations in Met
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00533:Met APN 6 17534937 unclassified probably benign
IGL01066:Met APN 6 17535105 critical splice donor site probably null
IGL01344:Met APN 6 17547032 missense probably benign 0.44
IGL01413:Met APN 6 17558896 splice site probably benign
IGL01608:Met APN 6 17558730 missense probably damaging 1.00
IGL01613:Met APN 6 17540577 missense probably damaging 1.00
IGL01820:Met APN 6 17534231 missense possibly damaging 0.89
IGL01843:Met APN 6 17491701 missense probably damaging 1.00
IGL02014:Met APN 6 17527257 splice site probably benign
IGL02027:Met APN 6 17563727 splice site probably benign
IGL02243:Met APN 6 17549094 missense probably damaging 1.00
IGL02373:Met APN 6 17491529 missense probably damaging 1.00
IGL02616:Met APN 6 17553347 missense probably damaging 1.00
IGL02702:Met APN 6 17534143 missense possibly damaging 0.92
IGL02704:Met APN 6 17491257 missense possibly damaging 0.62
IGL02714:Met APN 6 17491852 nonsense probably null
IGL02936:Met APN 6 17553397 missense probably damaging 1.00
IGL02943:Met APN 6 17535929 missense possibly damaging 0.84
IGL03057:Met APN 6 17558766 missense probably damaging 1.00
IGL03124:Met APN 6 17492078 missense probably benign 0.27
IGL03171:Met APN 6 17562273 splice site probably benign
IGL03266:Met APN 6 17540538 missense possibly damaging 0.61
IGL03285:Met APN 6 17553337 missense probably damaging 0.98
R0453:Met UTSW 6 17534198 missense possibly damaging 0.88
R0543:Met UTSW 6 17491970 missense probably damaging 1.00
R0601:Met UTSW 6 17555632 splice site probably null
R0652:Met UTSW 6 17491710 missense probably benign 0.00
R0941:Met UTSW 6 17491394 missense probably damaging 1.00
R1142:Met UTSW 6 17527183 nonsense probably null
R1569:Met UTSW 6 17531504 nonsense probably null
R1744:Met UTSW 6 17540646 missense possibly damaging 0.47
R2224:Met UTSW 6 17563722 splice site probably null
R2308:Met UTSW 6 17491742 missense probably benign 0.00
R2369:Met UTSW 6 17531528 missense probably benign 0.04
R2393:Met UTSW 6 17534198 missense probably damaging 0.99
R2419:Met UTSW 6 17535830 splice site probably benign
R2483:Met UTSW 6 17549086 missense probably damaging 1.00
R2511:Met UTSW 6 17491967 missense probably damaging 1.00
R3622:Met UTSW 6 17549086 missense probably damaging 1.00
R3623:Met UTSW 6 17549086 missense probably damaging 1.00
R3624:Met UTSW 6 17549086 missense probably damaging 1.00
R4050:Met UTSW 6 17533984 missense probably benign
R4051:Met UTSW 6 17548729 missense possibly damaging 0.86
R4159:Met UTSW 6 17562272 splice site probably null
R4208:Met UTSW 6 17548729 missense possibly damaging 0.86
R4622:Met UTSW 6 17513384 missense probably benign 0.19
R4672:Met UTSW 6 17571804 missense probably benign 0.33
R4737:Met UTSW 6 17491541 missense probably damaging 1.00
R4738:Met UTSW 6 17491541 missense probably damaging 1.00
R4834:Met UTSW 6 17491413 missense probably damaging 0.97
R4846:Met UTSW 6 17491929 missense probably damaging 0.99
R4855:Met UTSW 6 17558797 missense probably damaging 1.00
R4878:Met UTSW 6 17549059 missense probably damaging 1.00
R4902:Met UTSW 6 17546996 missense probably damaging 1.00
R5208:Met UTSW 6 17526423 nonsense probably null
R5355:Met UTSW 6 17491362 missense probably damaging 1.00
R5415:Met UTSW 6 17527085 missense probably benign 0.01
R5556:Met UTSW 6 17534176 missense probably benign 0.04
R5590:Met UTSW 6 17548782 missense probably benign 0.00
R5683:Met UTSW 6 17571744 missense probably damaging 1.00
R5872:Met UTSW 6 17562198 missense probably damaging 1.00
R5891:Met UTSW 6 17491539 missense probably benign 0.02
R5895:Met UTSW 6 17531582 missense probably benign 0.02
R6063:Met UTSW 6 17491968 missense probably damaging 1.00
R6262:Met UTSW 6 17553404 missense probably benign 0.00
R6362:Met UTSW 6 17558733 missense probably damaging 1.00
R6747:Met UTSW 6 17571467 missense probably damaging 1.00
R6966:Met UTSW 6 17531532 missense possibly damaging 0.65
R6989:Met UTSW 6 17535928 missense possibly damaging 0.67
R6989:Met UTSW 6 17535929 missense probably damaging 1.00
R7017:Met UTSW 6 17491287 nonsense probably null
R7037:Met UTSW 6 17547128 intron probably benign
R7141:Met UTSW 6 17527155 missense probably benign 0.01
R7242:Met UTSW 6 17491317 missense probably damaging 1.00
R7282:Met UTSW 6 17547012 nonsense probably null
R7624:Met UTSW 6 17558835 missense probably damaging 1.00
R7770:Met UTSW 6 17491407 missense possibly damaging 0.79
R7797:Met UTSW 6 17533953 missense probably damaging 1.00
R8082:Met UTSW 6 17492313 missense probably damaging 0.98
R8109:Met UTSW 6 17562237 missense probably damaging 1.00
R8162:Met UTSW 6 17547062 missense probably damaging 0.98
R8315:Met UTSW 6 17533957 missense probably damaging 0.99
R8325:Met UTSW 6 17571672 missense probably damaging 1.00
R8348:Met UTSW 6 17571800 missense probably benign 0.00
R8354:Met UTSW 6 17491769 missense probably damaging 1.00
R8448:Met UTSW 6 17571800 missense probably benign 0.00
R8454:Met UTSW 6 17491769 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATATCGAAGCTGGAGGAGTCATGC -3'
(R):5'- ATGCAGTGGACCTCAGACTGGATG -3'

Sequencing Primer
(F):5'- CTGAATGTGTCTTGGCAGATCAAC -3'
(R):5'- GCCACAGCTAATGAGTTGATCATC -3'
Posted On2014-04-13