Incidental Mutation 'R1553:Psg18'
ID 170077
Institutional Source Beutler Lab
Gene Symbol Psg18
Ensembl Gene ENSMUSG00000003505
Gene Name pregnancy specific glycoprotein 18
Synonyms Cea-3, Cea3, mmCGM6
MMRRC Submission 039592-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.051) question?
Stock # R1553 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 18345422-18355009 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 18353481 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 84 (Y84C)
Ref Sequence ENSEMBL: ENSMUSP00000003597 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003597] [ENSMUST00000098783]
AlphaFold B2RSG7
Predicted Effect probably benign
Transcript: ENSMUST00000003597
AA Change: Y84C

PolyPhen 2 Score 0.193 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000003597
Gene: ENSMUSG00000003505
AA Change: Y84C

DomainStartEndE-ValueType
low complexity region 19 30 N/A INTRINSIC
IG 40 140 2.11e-2 SMART
IG 161 262 1.03e0 SMART
IG 281 380 2.15e-3 SMART
IGc2 398 462 1.58e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000098783
SMART Domains Protein: ENSMUSP00000096380
Gene: ENSMUSG00000003505

DomainStartEndE-ValueType
IG 40 141 1.03e0 SMART
IG 160 259 2.15e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182983
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 92.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb8 G T 5: 24,408,750 A649S probably damaging Het
Adam6a T A 12: 113,545,215 C403S probably damaging Het
Adgrg3 T C 8: 95,040,268 F417S possibly damaging Het
Ago1 T C 4: 126,440,401 E439G probably damaging Het
Alox15 A G 11: 70,349,632 V241A possibly damaging Het
Arhgap6 A G X: 169,265,484 H566R probably damaging Het
Asap1 A T 15: 64,152,852 F345I probably benign Het
Atp1b2 A G 11: 69,602,852 Y134H probably damaging Het
Atp8b3 G A 10: 80,532,542 T199M probably damaging Het
Calb1 A T 4: 15,895,656 S115C probably damaging Het
Ccdc68 A T 18: 69,940,121 I47F probably damaging Het
Cdc42bpa A T 1: 180,093,975 N560I probably benign Het
Cdhr3 T C 12: 33,042,371 D747G probably benign Het
Cdk5rap1 T G 2: 154,352,251 N378T probably damaging Het
Chil4 T G 3: 106,203,690 N296T probably benign Het
Cryaa G A 17: 31,679,559 V87I probably damaging Het
Csk G A 9: 57,630,942 L28F probably damaging Het
Cspp1 A G 1: 10,085,897 N444D possibly damaging Het
Cyp2j8 A G 4: 96,475,557 Y290H probably benign Het
Eps8l1 A T 7: 4,477,449 D563V probably damaging Het
Fam111a A T 19: 12,587,318 S144C possibly damaging Het
Fam135a A T 1: 24,021,870 S1145R probably damaging Het
Fpr2 T A 17: 17,893,594 V284D possibly damaging Het
Furin A G 7: 80,398,592 probably null Het
Gatd1 T C 7: 141,409,893 T135A probably benign Het
Gdf3 A G 6: 122,609,765 S68P probably benign Het
Gm6871 T C 7: 41,546,398 H305R probably benign Het
Grip1 A G 10: 120,054,851 S917G probably damaging Het
Hdac10 T A 15: 89,125,515 E388V possibly damaging Het
Hectd1 T C 12: 51,773,878 N1176S probably damaging Het
Hectd4 A G 5: 121,349,259 D3439G probably benign Het
Kcna4 T C 2: 107,296,687 Y589H probably benign Het
Kcnk5 A T 14: 20,142,394 L233Q probably damaging Het
Kcnt1 T C 2: 25,900,385 I453T probably damaging Het
Kifc3 A G 8: 95,106,542 I440T possibly damaging Het
Krt10 C A 11: 99,385,980 G40* probably null Het
Lce1i A T 3: 92,777,795 C25S unknown Het
Met A G 6: 17,491,461 N74S probably benign Het
Naa35 G A 13: 59,618,279 probably null Het
Naalad2 T C 9: 18,378,669 N221S probably benign Het
Nolc1 AGCG AGCGGCG 19: 46,081,375 probably benign Het
Nsmf T C 2: 25,060,259 V181A probably damaging Het
Nwd2 T A 5: 63,800,505 S393T probably benign Het
Olfr530 T A 7: 140,373,038 T191S probably damaging Het
Olfr575 T A 7: 102,955,218 I128L possibly damaging Het
Olfr709-ps1 A T 7: 106,926,994 V155E possibly damaging Het
Papola T A 12: 105,820,410 S453R probably benign Het
Paqr9 A G 9: 95,560,209 N84S probably damaging Het
Pde5a T C 3: 122,778,936 V290A probably benign Het
Prf1 T C 10: 61,303,169 V302A probably damaging Het
Rasgrf2 C T 13: 91,890,664 R1021H probably damaging Het
Rnf114 G T 2: 167,512,602 R201L possibly damaging Het
Rp1l1 A G 14: 64,031,894 E1643G probably benign Het
Scg3 T A 9: 75,669,304 E263V probably null Het
Scn2a C T 2: 65,713,836 R854* probably null Het
Setdb2 T C 14: 59,417,485 K319E probably benign Het
Stub1 A T 17: 25,832,123 V95E probably damaging Het
Tas2r140 T A 6: 133,055,508 N96Y probably damaging Het
Tecta T A 9: 42,348,186 D1467V probably damaging Het
Tenm3 T A 8: 48,236,421 T2044S probably damaging Het
Tlr2 T A 3: 83,837,463 M438L probably benign Het
Tmem179 T C 12: 112,504,660 Y106C probably benign Het
Tspan7 A G X: 10,585,615 H187R probably benign Het
Ttn T C 2: 76,927,275 D3332G probably damaging Het
Upp2 T C 2: 58,790,140 F326S probably damaging Het
Usp2 T A 9: 44,092,155 D224E probably damaging Het
Vmn1r5 T A 6: 56,985,498 F53I probably benign Het
Wapl T A 14: 34,729,190 L727H probably damaging Het
Wipf1 T C 2: 73,437,526 D176G possibly damaging Het
Xpnpep1 G T 19: 53,006,338 D243E probably benign Het
Zfp616 A T 11: 74,083,918 I429F possibly damaging Het
Zfyve26 G A 12: 79,287,761 P161L probably benign Het
Other mutations in Psg18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01458:Psg18 APN 7 18354816 start codon destroyed probably null 0.99
IGL01748:Psg18 APN 7 18353551 missense probably benign 0.05
IGL01767:Psg18 APN 7 18353397 missense possibly damaging 0.80
IGL02727:Psg18 APN 7 18345950 missense probably damaging 1.00
IGL02744:Psg18 APN 7 18349402 missense probably benign 0.38
G1Funyon:Psg18 UTSW 7 18353377 missense probably damaging 0.99
PIT4466001:Psg18 UTSW 7 18349316 missense probably benign 0.30
R0331:Psg18 UTSW 7 18353308 missense probably benign 0.03
R1077:Psg18 UTSW 7 18351075 missense possibly damaging 0.84
R1171:Psg18 UTSW 7 18346079 missense probably benign 0.10
R1173:Psg18 UTSW 7 18354817 start codon destroyed probably null 0.97
R1234:Psg18 UTSW 7 18349190 missense probably damaging 1.00
R1632:Psg18 UTSW 7 18350899 missense probably benign 0.02
R2108:Psg18 UTSW 7 18350874 missense probably damaging 1.00
R2439:Psg18 UTSW 7 18346119 missense probably benign 0.24
R3032:Psg18 UTSW 7 18350979 missense probably benign 0.01
R3053:Psg18 UTSW 7 18349193 missense probably damaging 1.00
R3432:Psg18 UTSW 7 18349171 missense possibly damaging 0.61
R3725:Psg18 UTSW 7 18354823 start gained probably benign
R4479:Psg18 UTSW 7 18350862 missense probably benign 0.01
R4480:Psg18 UTSW 7 18350862 missense probably benign 0.01
R4846:Psg18 UTSW 7 18350786 nonsense probably null
R4858:Psg18 UTSW 7 18353484 missense possibly damaging 0.49
R5010:Psg18 UTSW 7 18349354 missense probably damaging 1.00
R5225:Psg18 UTSW 7 18345949 missense probably damaging 1.00
R5450:Psg18 UTSW 7 18353425 missense probably benign 0.32
R5526:Psg18 UTSW 7 18349348 missense probably damaging 1.00
R5840:Psg18 UTSW 7 18346602 intron probably benign
R6409:Psg18 UTSW 7 18353521 missense probably benign
R7164:Psg18 UTSW 7 18350937 missense possibly damaging 0.89
R7276:Psg18 UTSW 7 18345984 missense probably damaging 0.99
R7768:Psg18 UTSW 7 18346028 missense probably damaging 1.00
R8301:Psg18 UTSW 7 18353377 missense probably damaging 0.99
R8700:Psg18 UTSW 7 18353625 missense probably damaging 1.00
R8982:Psg18 UTSW 7 18349375 missense probably benign 0.20
R9042:Psg18 UTSW 7 18349122 missense probably benign 0.44
R9054:Psg18 UTSW 7 18353525 missense possibly damaging 0.82
Z1176:Psg18 UTSW 7 18354787 missense probably benign 0.07
Z1177:Psg18 UTSW 7 18349115 missense probably benign 0.30
Z1177:Psg18 UTSW 7 18349198 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- AAATGCTCAGTCCCCAACATGGAG -3'
(R):5'- CCACTGCCAGAGTCACCATTGAATC -3'

Sequencing Primer
(F):5'- CTTCTGTGTGCCTAGTAAGAAGACC -3'
(R):5'- GCCAGAGTCACCATTGAATCTTTAC -3'
Posted On 2014-04-13