Mutagenetix > Incidental Mutation

Incidental Mutation 'R1553:Zfyve26'

170104

Institutional Source

Beutler Lab

Gene Symbol

Zfyve26

Ensembl Gene

ENSMUSG00000066440

Gene Name

zinc finger, FYVE domain containing 26

Synonyms

A630028O16Rik, 9330197E15Rik, LOC380767

MMRRC Submission

039592-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1553 (G1)

Quality Score

163

Status

Not validated

Chromosome

Chromosomal Location

79279120-79343078 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 79334535 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Proline to Leucine at position 161 (P161L)

Ref Sequence

ENSEMBL: ENSMUSP00000151280 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021547] [ENSMUST00000218377]

AlphaFold

Q5DU37

Predicted Effect

probably benign
Transcript: ENSMUST00000021547
AA Change: P161L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000021547
Gene: ENSMUSG00000066440
AA Change: P161L

Domain	Start	End	E-Value	Type
low complexity region	8	24	N/A	INTRINSIC
low complexity region	233	244	N/A	INTRINSIC
low complexity region	752	775	N/A	INTRINSIC
low complexity region	778	796	N/A	INTRINSIC
low complexity region	982	1001	N/A	INTRINSIC
low complexity region	1073	1091	N/A	INTRINSIC
low complexity region	1104	1115	N/A	INTRINSIC
low complexity region	1151	1163	N/A	INTRINSIC
low complexity region	1177	1192	N/A	INTRINSIC
low complexity region	1228	1241	N/A	INTRINSIC
low complexity region	1565	1584	N/A	INTRINSIC
low complexity region	1743	1770	N/A	INTRINSIC
FYVE	1794	1863	1.49e-27	SMART
low complexity region	2486	2498	N/A	INTRINSIC
low complexity region	2517	2528	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000218377
AA Change: P161L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218510

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219842

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 96.0%
20x: 92.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains a FYVE zinc finger binding domain. The presence of this domain is thought to target these proteins to membrane lipids through interaction with phospholipids in the membrane. Mutations in this gene are associated with autosomal recessive spastic paraplegia-15. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygoys for a null allele display a late-onset spastic gait disorder with cerebellar ataxia, axon degeneration, and progressive loss of cortical motoneurons and Purkinje cells preceded by accumulation of autofluorescent, electron-dense, membrane-enclosed material in lysosomal structures. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb8	G	T	5: 24,613,748 (GRCm39)	A649S	probably damaging	Het
Adam6a	T	A	12: 113,508,835 (GRCm39)	C403S	probably damaging	Het
Adgrg3	T	C	8: 95,766,896 (GRCm39)	F417S	possibly damaging	Het
Ago1	T	C	4: 126,334,194 (GRCm39)	E439G	probably damaging	Het
Alox15	A	G	11: 70,240,458 (GRCm39)	V241A	possibly damaging	Het
Arhgap6	A	G	X: 168,048,480 (GRCm39)	H566R	probably damaging	Het
Asap1	A	T	15: 64,024,701 (GRCm39)	F345I	probably benign	Het
Atp1b2	A	G	11: 69,493,678 (GRCm39)	Y134H	probably damaging	Het
Atp8b3	G	A	10: 80,368,376 (GRCm39)	T199M	probably damaging	Het
Calb1	A	T	4: 15,895,656 (GRCm39)	S115C	probably damaging	Het
Ccdc68	A	T	18: 70,073,192 (GRCm39)	I47F	probably damaging	Het
Cdc42bpa	A	T	1: 179,921,540 (GRCm39)	N560I	probably benign	Het
Cdhr3	T	C	12: 33,092,370 (GRCm39)	D747G	probably benign	Het
Cdk5rap1	T	G	2: 154,194,171 (GRCm39)	N378T	probably damaging	Het
Chil4	T	G	3: 106,111,006 (GRCm39)	N296T	probably benign	Het
Cryaa	G	A	17: 31,898,533 (GRCm39)	V87I	probably damaging	Het
Csk	G	A	9: 57,538,225 (GRCm39)	L28F	probably damaging	Het
Cspp1	A	G	1: 10,156,122 (GRCm39)	N444D	possibly damaging	Het
Cyp2j8	A	G	4: 96,363,794 (GRCm39)	Y290H	probably benign	Het
Eps8l1	A	T	7: 4,480,448 (GRCm39)	D563V	probably damaging	Het
Fam111a	A	T	19: 12,564,682 (GRCm39)	S144C	possibly damaging	Het
Fam135a	A	T	1: 24,060,951 (GRCm39)	S1145R	probably damaging	Het
Fpr2	T	A	17: 18,113,856 (GRCm39)	V284D	possibly damaging	Het
Furin	A	G	7: 80,048,340 (GRCm39)		probably null	Het
Gatd1	T	C	7: 140,989,806 (GRCm39)	T135A	probably benign	Het
Gdf3	A	G	6: 122,586,724 (GRCm39)	S68P	probably benign	Het
Gm6871	T	C	7: 41,195,822 (GRCm39)	H305R	probably benign	Het
Grip1	A	G	10: 119,890,756 (GRCm39)	S917G	probably damaging	Het
Hdac10	T	A	15: 89,009,718 (GRCm39)	E388V	possibly damaging	Het
Hectd1	T	C	12: 51,820,661 (GRCm39)	N1176S	probably damaging	Het
Hectd4	A	G	5: 121,487,322 (GRCm39)	D3439G	probably benign	Het
Kcna4	T	C	2: 107,127,032 (GRCm39)	Y589H	probably benign	Het
Kcnk5	A	T	14: 20,192,462 (GRCm39)	L233Q	probably damaging	Het
Kcnt1	T	C	2: 25,790,397 (GRCm39)	I453T	probably damaging	Het
Kifc3	A	G	8: 95,833,170 (GRCm39)	I440T	possibly damaging	Het
Krt10	C	A	11: 99,276,806 (GRCm39)	G40*	probably null	Het
Lce1i	A	T	3: 92,685,102 (GRCm39)	C25S	unknown	Het
Met	A	G	6: 17,491,460 (GRCm39)	N74S	probably benign	Het
Naa35	G	A	13: 59,766,093 (GRCm39)		probably null	Het
Naalad2	T	C	9: 18,289,965 (GRCm39)	N221S	probably benign	Het
Nolc1	AGCG	AGCGGCG	19: 46,069,814 (GRCm39)		probably benign	Het
Nsmf	T	C	2: 24,950,271 (GRCm39)	V181A	probably damaging	Het
Nwd2	T	A	5: 63,957,848 (GRCm39)	S393T	probably benign	Het
Or12j3	T	A	7: 139,952,951 (GRCm39)	T191S	probably damaging	Het
Or2d3c	A	T	7: 106,526,201 (GRCm39)	V155E	possibly damaging	Het
Or51a6	T	A	7: 102,604,425 (GRCm39)	I128L	possibly damaging	Het
Papola	T	A	12: 105,786,669 (GRCm39)	S453R	probably benign	Het
Paqr9	A	G	9: 95,442,262 (GRCm39)	N84S	probably damaging	Het
Pde5a	T	C	3: 122,572,585 (GRCm39)	V290A	probably benign	Het
Prf1	T	C	10: 61,138,948 (GRCm39)	V302A	probably damaging	Het
Psg18	T	C	7: 18,087,406 (GRCm39)	Y84C	probably benign	Het
Rasgrf2	C	T	13: 92,038,783 (GRCm39)	R1021H	probably damaging	Het
Rnf114	G	T	2: 167,354,522 (GRCm39)	R201L	possibly damaging	Het
Rp1l1	A	G	14: 64,269,343 (GRCm39)	E1643G	probably benign	Het
Scg3	T	A	9: 75,576,586 (GRCm39)	E263V	probably null	Het
Scn2a	C	T	2: 65,544,180 (GRCm39)	R854*	probably null	Het
Setdb2	T	C	14: 59,654,934 (GRCm39)	K319E	probably benign	Het
Stub1	A	T	17: 26,051,097 (GRCm39)	V95E	probably damaging	Het
Tas2r140	T	A	6: 133,032,471 (GRCm39)	N96Y	probably damaging	Het
Tecta	T	A	9: 42,259,482 (GRCm39)	D1467V	probably damaging	Het
Tenm3	T	A	8: 48,689,456 (GRCm39)	T2044S	probably damaging	Het
Tlr2	T	A	3: 83,744,770 (GRCm39)	M438L	probably benign	Het
Tmem179	T	C	12: 112,471,094 (GRCm39)	Y106C	probably benign	Het
Tspan7	A	G	X: 10,451,854 (GRCm39)	H187R	probably benign	Het
Ttn	T	C	2: 76,757,619 (GRCm39)	D3332G	probably damaging	Het
Upp2	T	C	2: 58,680,152 (GRCm39)	F326S	probably damaging	Het
Usp2	T	A	9: 44,003,452 (GRCm39)	D224E	probably damaging	Het
Vmn1r5	T	A	6: 56,962,483 (GRCm39)	F53I	probably benign	Het
Wapl	T	A	14: 34,451,147 (GRCm39)	L727H	probably damaging	Het
Wipf1	T	C	2: 73,267,870 (GRCm39)	D176G	possibly damaging	Het
Xpnpep1	G	T	19: 52,994,769 (GRCm39)	D243E	probably benign	Het
Zfp616	A	T	11: 73,974,744 (GRCm39)	I429F	possibly damaging	Het

Other mutations in Zfyve26

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00090:Zfyve26	APN	12	79,296,234 (GRCm39)	unclassified	probably benign
IGL00940:Zfyve26	APN	12	79,327,674 (GRCm39)	missense	probably benign
IGL01148:Zfyve26	APN	12	79,307,644 (GRCm39)	missense	probably benign	0.01
IGL01347:Zfyve26	APN	12	79,298,957 (GRCm39)	splice site	probably null
IGL01472:Zfyve26	APN	12	79,323,117 (GRCm39)	missense	probably benign	0.01
IGL01490:Zfyve26	APN	12	79,291,147 (GRCm39)	missense	probably damaging	1.00
IGL01516:Zfyve26	APN	12	79,334,625 (GRCm39)	missense	probably benign	0.37
IGL01642:Zfyve26	APN	12	79,308,348 (GRCm39)	splice site	probably null
IGL01689:Zfyve26	APN	12	79,330,827 (GRCm39)	missense	possibly damaging	0.71
IGL01877:Zfyve26	APN	12	79,334,218 (GRCm39)	missense	probably damaging	1.00
IGL01997:Zfyve26	APN	12	79,291,174 (GRCm39)	missense	probably benign	0.00
IGL02077:Zfyve26	APN	12	79,323,169 (GRCm39)	missense	possibly damaging	0.54
IGL02437:Zfyve26	APN	12	79,315,621 (GRCm39)	missense	probably benign	0.01
IGL02933:Zfyve26	APN	12	79,326,854 (GRCm39)	missense	possibly damaging	0.94
IGL02937:Zfyve26	APN	12	79,285,794 (GRCm39)	missense	probably benign	0.08
IGL02982:Zfyve26	APN	12	79,310,644 (GRCm39)	missense	probably damaging	0.99
IGL03064:Zfyve26	APN	12	79,308,565 (GRCm39)	missense	probably damaging	1.00
IGL03086:Zfyve26	APN	12	79,342,338 (GRCm39)	missense	probably damaging	0.96
IGL03146:Zfyve26	APN	12	79,330,846 (GRCm39)	nonsense	probably null
challenge	UTSW	12	79,317,610 (GRCm39)	critical splice donor site	probably null
fourteener	UTSW	12	79,302,037 (GRCm39)	missense	probably damaging	1.00
IGL02799:Zfyve26	UTSW	12	79,320,084 (GRCm39)	missense	probably benign	0.28
R0318:Zfyve26	UTSW	12	79,323,055 (GRCm39)	missense	probably damaging	1.00
R0513:Zfyve26	UTSW	12	79,291,258 (GRCm39)	missense	probably damaging	1.00
R0582:Zfyve26	UTSW	12	79,292,996 (GRCm39)	missense	probably damaging	1.00
R0586:Zfyve26	UTSW	12	79,315,502 (GRCm39)	missense	possibly damaging	0.96
R0718:Zfyve26	UTSW	12	79,312,576 (GRCm39)	splice site	probably benign
R0738:Zfyve26	UTSW	12	79,342,308 (GRCm39)	missense	probably damaging	1.00
R0781:Zfyve26	UTSW	12	79,326,841 (GRCm39)	missense	probably damaging	0.99
R0894:Zfyve26	UTSW	12	79,320,372 (GRCm39)	missense	possibly damaging	0.80
R1109:Zfyve26	UTSW	12	79,318,901 (GRCm39)	missense	probably damaging	1.00
R1110:Zfyve26	UTSW	12	79,326,841 (GRCm39)	missense	probably damaging	0.99
R1186:Zfyve26	UTSW	12	79,310,723 (GRCm39)	missense	probably damaging	1.00
R1295:Zfyve26	UTSW	12	79,321,694 (GRCm39)	missense	probably damaging	1.00
R1430:Zfyve26	UTSW	12	79,329,591 (GRCm39)	missense	probably benign	0.07
R1439:Zfyve26	UTSW	12	79,298,937 (GRCm39)	missense	probably benign	0.03
R1517:Zfyve26	UTSW	12	79,298,925 (GRCm39)	missense	probably damaging	0.98
R1721:Zfyve26	UTSW	12	79,308,573 (GRCm39)	missense	possibly damaging	0.94
R1758:Zfyve26	UTSW	12	79,285,718 (GRCm39)	missense	probably damaging	1.00
R1779:Zfyve26	UTSW	12	79,325,237 (GRCm39)	missense	probably damaging	1.00
R1785:Zfyve26	UTSW	12	79,315,208 (GRCm39)	missense	possibly damaging	0.48
R1786:Zfyve26	UTSW	12	79,315,208 (GRCm39)	missense	possibly damaging	0.48
R1826:Zfyve26	UTSW	12	79,315,823 (GRCm39)	missense	probably damaging	1.00
R1833:Zfyve26	UTSW	12	79,333,032 (GRCm39)	missense	probably benign	0.36
R1868:Zfyve26	UTSW	12	79,308,573 (GRCm39)	missense	possibly damaging	0.94
R1900:Zfyve26	UTSW	12	79,311,125 (GRCm39)	missense	probably damaging	1.00
R1928:Zfyve26	UTSW	12	79,286,744 (GRCm39)	nonsense	probably null
R1982:Zfyve26	UTSW	12	79,302,017 (GRCm39)	missense	possibly damaging	0.55
R2062:Zfyve26	UTSW	12	79,330,806 (GRCm39)	splice site	probably null
R2071:Zfyve26	UTSW	12	79,334,220 (GRCm39)	missense	possibly damaging	0.95
R2130:Zfyve26	UTSW	12	79,315,208 (GRCm39)	missense	possibly damaging	0.48
R2132:Zfyve26	UTSW	12	79,315,208 (GRCm39)	missense	possibly damaging	0.48
R2133:Zfyve26	UTSW	12	79,315,208 (GRCm39)	missense	possibly damaging	0.48
R2135:Zfyve26	UTSW	12	79,292,826 (GRCm39)	missense	possibly damaging	0.80
R2207:Zfyve26	UTSW	12	79,292,861 (GRCm39)	missense	probably damaging	0.99
R2280:Zfyve26	UTSW	12	79,321,814 (GRCm39)	missense	probably damaging	1.00
R2352:Zfyve26	UTSW	12	79,330,890 (GRCm39)	missense	probably damaging	1.00
R2398:Zfyve26	UTSW	12	79,329,573 (GRCm39)	splice site	probably null
R3084:Zfyve26	UTSW	12	79,312,457 (GRCm39)	splice site	probably benign
R3086:Zfyve26	UTSW	12	79,312,457 (GRCm39)	splice site	probably benign
R4626:Zfyve26	UTSW	12	79,315,844 (GRCm39)	missense	possibly damaging	0.95
R4727:Zfyve26	UTSW	12	79,291,170 (GRCm39)	missense	probably benign	0.16
R4908:Zfyve26	UTSW	12	79,296,469 (GRCm39)	splice site	probably null
R4926:Zfyve26	UTSW	12	79,321,785 (GRCm39)	missense	probably benign
R4990:Zfyve26	UTSW	12	79,334,607 (GRCm39)	missense	probably damaging	1.00
R4999:Zfyve26	UTSW	12	79,327,159 (GRCm39)	nonsense	probably null
R5029:Zfyve26	UTSW	12	79,333,097 (GRCm39)	missense	probably damaging	0.99
R5070:Zfyve26	UTSW	12	79,302,135 (GRCm39)	missense	probably damaging	1.00
R5100:Zfyve26	UTSW	12	79,326,832 (GRCm39)	nonsense	probably null
R5252:Zfyve26	UTSW	12	79,315,756 (GRCm39)	missense	probably damaging	1.00
R5318:Zfyve26	UTSW	12	79,317,624 (GRCm39)	missense	probably benign	0.35
R5509:Zfyve26	UTSW	12	79,293,295 (GRCm39)	missense	probably damaging	1.00
R5574:Zfyve26	UTSW	12	79,286,698 (GRCm39)	missense	possibly damaging	0.63
R5735:Zfyve26	UTSW	12	79,320,147 (GRCm39)	missense	probably damaging	0.96
R5756:Zfyve26	UTSW	12	79,311,131 (GRCm39)	missense	probably damaging	1.00
R5773:Zfyve26	UTSW	12	79,334,511 (GRCm39)	missense	probably damaging	1.00
R5834:Zfyve26	UTSW	12	79,313,311 (GRCm39)	missense	probably benign	0.30
R6075:Zfyve26	UTSW	12	79,340,628 (GRCm39)	missense	possibly damaging	0.74
R6184:Zfyve26	UTSW	12	79,315,501 (GRCm39)	missense	probably damaging	0.98
R6235:Zfyve26	UTSW	12	79,296,373 (GRCm39)	missense	probably damaging	1.00
R6247:Zfyve26	UTSW	12	79,329,758 (GRCm39)	missense	probably benign	0.04
R6320:Zfyve26	UTSW	12	79,286,776 (GRCm39)	missense	probably damaging	0.97
R6548:Zfyve26	UTSW	12	79,285,109 (GRCm39)	missense	probably damaging	1.00
R6887:Zfyve26	UTSW	12	79,313,223 (GRCm39)	missense	probably damaging	1.00
R7133:Zfyve26	UTSW	12	79,330,926 (GRCm39)	missense	probably benign	0.06
R7152:Zfyve26	UTSW	12	79,325,888 (GRCm39)	missense	probably benign	0.42
R7165:Zfyve26	UTSW	12	79,327,179 (GRCm39)	missense	probably damaging	1.00
R7181:Zfyve26	UTSW	12	79,315,182 (GRCm39)	missense	probably benign	0.00
R7223:Zfyve26	UTSW	12	79,292,945 (GRCm39)	missense	probably damaging	0.99
R7296:Zfyve26	UTSW	12	79,325,146 (GRCm39)	splice site	probably null
R7299:Zfyve26	UTSW	12	79,329,758 (GRCm39)	missense	probably benign	0.01
R7301:Zfyve26	UTSW	12	79,329,758 (GRCm39)	missense	probably benign	0.01
R7302:Zfyve26	UTSW	12	79,297,942 (GRCm39)	missense	probably damaging	1.00
R7355:Zfyve26	UTSW	12	79,286,828 (GRCm39)	missense	probably damaging	1.00
R7466:Zfyve26	UTSW	12	79,334,581 (GRCm39)	missense	probably benign	0.00
R7540:Zfyve26	UTSW	12	79,315,450 (GRCm39)	missense	probably damaging	0.99
R7552:Zfyve26	UTSW	12	79,337,731 (GRCm39)	missense	probably damaging	0.97
R7762:Zfyve26	UTSW	12	79,315,409 (GRCm39)	missense	probably benign	0.02
R7806:Zfyve26	UTSW	12	79,327,129 (GRCm39)	critical splice donor site	probably null
R7821:Zfyve26	UTSW	12	79,302,098 (GRCm39)	missense	probably damaging	1.00
R8141:Zfyve26	UTSW	12	79,315,331 (GRCm39)	missense	possibly damaging	0.79
R8190:Zfyve26	UTSW	12	79,327,610 (GRCm39)	missense	probably benign	0.00
R8207:Zfyve26	UTSW	12	79,307,605 (GRCm39)	missense	probably damaging	1.00
R8210:Zfyve26	UTSW	12	79,302,037 (GRCm39)	missense	probably damaging	1.00
R8500:Zfyve26	UTSW	12	79,334,454 (GRCm39)	missense	probably damaging	0.99
R8686:Zfyve26	UTSW	12	79,334,227 (GRCm39)	missense	probably benign
R8758:Zfyve26	UTSW	12	79,311,083 (GRCm39)	critical splice donor site	probably benign
R8826:Zfyve26	UTSW	12	79,285,742 (GRCm39)	missense	probably benign	0.05
R8877:Zfyve26	UTSW	12	79,334,152 (GRCm39)	missense	probably benign	0.05
R9067:Zfyve26	UTSW	12	79,318,915 (GRCm39)	missense	probably damaging	0.99
R9195:Zfyve26	UTSW	12	79,311,168 (GRCm39)	missense	probably benign	0.12
R9269:Zfyve26	UTSW	12	79,323,076 (GRCm39)	missense	possibly damaging	0.73
R9273:Zfyve26	UTSW	12	79,317,610 (GRCm39)	critical splice donor site	probably null
R9340:Zfyve26	UTSW	12	79,321,680 (GRCm39)	nonsense	probably null
R9348:Zfyve26	UTSW	12	79,315,231 (GRCm39)	missense	possibly damaging	0.81
R9482:Zfyve26	UTSW	12	79,291,239 (GRCm39)	missense	probably damaging	1.00
R9536:Zfyve26	UTSW	12	79,298,046 (GRCm39)	missense	probably benign	0.32
R9653:Zfyve26	UTSW	12	79,334,418 (GRCm39)	missense	probably benign
R9676:Zfyve26	UTSW	12	79,330,959 (GRCm39)	missense	probably benign	0.01
R9797:Zfyve26	UTSW	12	79,293,006 (GRCm39)	missense	probably damaging	0.98
RF010:Zfyve26	UTSW	12	79,302,112 (GRCm39)	missense	probably damaging	1.00
X0020:Zfyve26	UTSW	12	79,285,779 (GRCm39)	missense	probably damaging	1.00
Z1176:Zfyve26	UTSW	12	79,315,307 (GRCm39)	missense	probably benign	0.07
Z1177:Zfyve26	UTSW	12	79,334,149 (GRCm39)	missense	probably null	1.00

Predicted Primers

PCR Primer
(F):5'- GGTCTCCAACAGTTCCTCACACAG -3'
(R):5'- GCTCCTGCATACATAACCACCTGG -3'

Sequencing Primer
(F):5'- AGCTCAGCTTTGCAGCATAG -3'
(R):5'- TGGGTGACCCACCACAATC -3'

Posted On

2014-04-13