Incidental Mutation 'R1553:Adam6a'
ID170107
Institutional Source Beutler Lab
Gene Symbol Adam6a
Ensembl Gene ENSMUSG00000043945
Gene Namea disintegrin and metallopeptidase domain 6A
SynonymsAdam6
MMRRC Submission 039592-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R1553 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location113543908-113546465 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 113545215 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 403 (C403S)
Ref Sequence ENSEMBL: ENSMUSP00000059315 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053086]
Predicted Effect probably damaging
Transcript: ENSMUST00000053086
AA Change: C403S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000059315
Gene: ENSMUSG00000043945
AA Change: C403S

DomainStartEndE-ValueType
Pfam:Pep_M12B_propep 30 167 6.9e-17 PFAM
Pfam:Reprolysin 222 407 4e-15 PFAM
DISIN 427 502 1.63e-33 SMART
ACR 503 640 7.46e-62 SMART
transmembrane domain 704 726 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 92.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb8 G T 5: 24,408,750 A649S probably damaging Het
Adgrg3 T C 8: 95,040,268 F417S possibly damaging Het
Ago1 T C 4: 126,440,401 E439G probably damaging Het
Alox15 A G 11: 70,349,632 V241A possibly damaging Het
Arhgap6 A G X: 169,265,484 H566R probably damaging Het
Asap1 A T 15: 64,152,852 F345I probably benign Het
Atp1b2 A G 11: 69,602,852 Y134H probably damaging Het
Atp8b3 G A 10: 80,532,542 T199M probably damaging Het
Calb1 A T 4: 15,895,656 S115C probably damaging Het
Ccdc68 A T 18: 69,940,121 I47F probably damaging Het
Cdc42bpa A T 1: 180,093,975 N560I probably benign Het
Cdhr3 T C 12: 33,042,371 D747G probably benign Het
Cdk5rap1 T G 2: 154,352,251 N378T probably damaging Het
Chil4 T G 3: 106,203,690 N296T probably benign Het
Cryaa G A 17: 31,679,559 V87I probably damaging Het
Csk G A 9: 57,630,942 L28F probably damaging Het
Cspp1 A G 1: 10,085,897 N444D possibly damaging Het
Cyp2j8 A G 4: 96,475,557 Y290H probably benign Het
Eps8l1 A T 7: 4,477,449 D563V probably damaging Het
Fam111a A T 19: 12,587,318 S144C possibly damaging Het
Fam135a A T 1: 24,021,870 S1145R probably damaging Het
Fpr2 T A 17: 17,893,594 V284D possibly damaging Het
Furin A G 7: 80,398,592 probably null Het
Gatd1 T C 7: 141,409,893 T135A probably benign Het
Gdf3 A G 6: 122,609,765 S68P probably benign Het
Gm6871 T C 7: 41,546,398 H305R probably benign Het
Grip1 A G 10: 120,054,851 S917G probably damaging Het
Hdac10 T A 15: 89,125,515 E388V possibly damaging Het
Hectd1 T C 12: 51,773,878 N1176S probably damaging Het
Hectd4 A G 5: 121,349,259 D3439G probably benign Het
Kcna4 T C 2: 107,296,687 Y589H probably benign Het
Kcnk5 A T 14: 20,142,394 L233Q probably damaging Het
Kcnt1 T C 2: 25,900,385 I453T probably damaging Het
Kifc3 A G 8: 95,106,542 I440T possibly damaging Het
Krt10 C A 11: 99,385,980 G40* probably null Het
Lce1i A T 3: 92,777,795 C25S unknown Het
Met A G 6: 17,491,461 N74S probably benign Het
Naa35 G A 13: 59,618,279 probably null Het
Naalad2 T C 9: 18,378,669 N221S probably benign Het
Nolc1 AGCG AGCGGCG 19: 46,081,375 probably benign Het
Nsmf T C 2: 25,060,259 V181A probably damaging Het
Nwd2 T A 5: 63,800,505 S393T probably benign Het
Olfr530 T A 7: 140,373,038 T191S probably damaging Het
Olfr575 T A 7: 102,955,218 I128L possibly damaging Het
Olfr709-ps1 A T 7: 106,926,994 V155E possibly damaging Het
Papola T A 12: 105,820,410 S453R probably benign Het
Paqr9 A G 9: 95,560,209 N84S probably damaging Het
Pde5a T C 3: 122,778,936 V290A probably benign Het
Prf1 T C 10: 61,303,169 V302A probably damaging Het
Psg18 T C 7: 18,353,481 Y84C probably benign Het
Rasgrf2 C T 13: 91,890,664 R1021H probably damaging Het
Rnf114 G T 2: 167,512,602 R201L possibly damaging Het
Rp1l1 A G 14: 64,031,894 E1643G probably benign Het
Scg3 T A 9: 75,669,304 E263V probably null Het
Scn2a C T 2: 65,713,836 R854* probably null Het
Setdb2 T C 14: 59,417,485 K319E probably benign Het
Stub1 A T 17: 25,832,123 V95E probably damaging Het
Tas2r140 T A 6: 133,055,508 N96Y probably damaging Het
Tecta T A 9: 42,348,186 D1467V probably damaging Het
Tenm3 T A 8: 48,236,421 T2044S probably damaging Het
Tlr2 T A 3: 83,837,463 M438L probably benign Het
Tmem179 T C 12: 112,504,660 Y106C probably benign Het
Tspan7 A G X: 10,585,615 H187R probably benign Het
Ttn T C 2: 76,927,275 D3332G probably damaging Het
Upp2 T C 2: 58,790,140 F326S probably damaging Het
Usp2 T A 9: 44,092,155 D224E probably damaging Het
Vmn1r5 T A 6: 56,985,498 F53I probably benign Het
Wapl T A 14: 34,729,190 L727H probably damaging Het
Wipf1 T C 2: 73,437,526 D176G possibly damaging Het
Xpnpep1 G T 19: 53,006,338 D243E probably benign Het
Zfp616 A T 11: 74,083,918 I429F possibly damaging Het
Zfyve26 G A 12: 79,287,761 P161L probably benign Het
Other mutations in Adam6a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00580:Adam6a APN 12 113545225 missense probably benign 0.00
IGL00896:Adam6a APN 12 113545410 missense possibly damaging 0.56
IGL01146:Adam6a APN 12 113544220 missense probably damaging 1.00
IGL01285:Adam6a APN 12 113546273 makesense probably null
IGL01839:Adam6a APN 12 113544622 missense probably benign 0.03
IGL01906:Adam6a APN 12 113544331 missense probably benign 0.19
IGL02306:Adam6a APN 12 113545723 missense possibly damaging 0.93
IGL03146:Adam6a APN 12 113545524 missense probably damaging 1.00
IGL03176:Adam6a APN 12 113546202 missense probably benign 0.00
IGL03365:Adam6a APN 12 113544145 missense possibly damaging 0.86
IGL03373:Adam6a APN 12 113545552 missense possibly damaging 0.55
PIT4802001:Adam6a UTSW 12 113545458 missense probably damaging 1.00
R0091:Adam6a UTSW 12 113544229 missense possibly damaging 0.46
R0149:Adam6a UTSW 12 113545749 missense probably damaging 1.00
R0348:Adam6a UTSW 12 113544717 missense probably damaging 0.99
R0376:Adam6a UTSW 12 113544690 missense probably damaging 1.00
R1471:Adam6a UTSW 12 113544393 missense probably damaging 1.00
R1474:Adam6a UTSW 12 113544449 missense possibly damaging 0.66
R1679:Adam6a UTSW 12 113544756 missense probably benign 0.00
R1808:Adam6a UTSW 12 113544714 missense probably benign 0.00
R1826:Adam6a UTSW 12 113546122 missense possibly damaging 0.46
R1856:Adam6a UTSW 12 113545303 missense probably damaging 1.00
R1916:Adam6a UTSW 12 113545936 missense probably benign
R2011:Adam6a UTSW 12 113545378 missense probably benign 0.09
R2049:Adam6a UTSW 12 113544429 missense probably benign 0.17
R2364:Adam6a UTSW 12 113544630 missense probably benign 0.05
R3820:Adam6a UTSW 12 113544178 missense probably benign 0.00
R4119:Adam6a UTSW 12 113544574 missense probably benign 0.06
R4540:Adam6a UTSW 12 113544499 missense probably damaging 1.00
R4627:Adam6a UTSW 12 113544949 missense probably benign
R4665:Adam6a UTSW 12 113544372 missense possibly damaging 0.64
R4859:Adam6a UTSW 12 113545989 missense probably damaging 1.00
R4997:Adam6a UTSW 12 113545371 missense probably damaging 1.00
R5270:Adam6a UTSW 12 113544127 missense possibly damaging 0.46
R5751:Adam6a UTSW 12 113544827 missense possibly damaging 0.79
R5775:Adam6a UTSW 12 113546266 missense possibly damaging 0.47
R5863:Adam6a UTSW 12 113544367 missense probably benign 0.01
R6154:Adam6a UTSW 12 113545672 missense probably benign 0.11
R6313:Adam6a UTSW 12 113545050 missense possibly damaging 0.56
R6316:Adam6a UTSW 12 113545576 missense probably benign 0.27
R6706:Adam6a UTSW 12 113545266 missense probably benign 0.00
R6845:Adam6a UTSW 12 113544097 missense possibly damaging 0.96
R7134:Adam6a UTSW 12 113545035 missense probably benign 0.04
R7179:Adam6a UTSW 12 113545671 missense probably benign 0.02
R7206:Adam6a UTSW 12 113546034 missense probably damaging 1.00
R7230:Adam6a UTSW 12 113545582 missense probably damaging 1.00
R7296:Adam6a UTSW 12 113545572 missense probably damaging 1.00
R7676:Adam6a UTSW 12 113544576 missense probably benign 0.00
R7730:Adam6a UTSW 12 113544040 missense possibly damaging 0.86
R7743:Adam6a UTSW 12 113544532 missense probably benign
R7841:Adam6a UTSW 12 113545458 missense probably damaging 1.00
R8356:Adam6a UTSW 12 113546137 missense probably benign 0.08
R8531:Adam6a UTSW 12 113545297 missense probably damaging 1.00
X0027:Adam6a UTSW 12 113545243 missense probably benign 0.01
Z1176:Adam6a UTSW 12 113545321 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TCGCCAGGAGATGATGCTGTTAATC -3'
(R):5'- TCTGGGCAAATGAACTTAGAGCCAC -3'

Sequencing Primer
(F):5'- TGGTCAACATGGTCGAAATCC -3'
(R):5'- TAGAGCCACTACAGTACTCTGG -3'
Posted On2014-04-13