Incidental Mutation 'R1553:Xpnpep1'
ID 170125
Institutional Source Beutler Lab
Gene Symbol Xpnpep1
Ensembl Gene ENSMUSG00000025027
Gene Name X-prolyl aminopeptidase (aminopeptidase P) 1, soluble
Synonyms D230045I08Rik
MMRRC Submission 039592-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1553 (G1)
Quality Score 134
Status Not validated
Chromosome 19
Chromosomal Location 52919710-53027093 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 52994769 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 243 (D243E)
Gene Model predicted gene model for transcript(s): [ENSMUST00000182500] [ENSMUST00000183108] [ENSMUST00000183274]
AlphaFold Q6P1B1
Predicted Effect probably benign
Transcript: ENSMUST00000069988
AA Change: D243E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000070946
Gene: ENSMUSG00000025027
AA Change: D243E

DomainStartEndE-ValueType
Pfam:Creatinase_N 10 154 5.2e-15 PFAM
Pfam:Creatinase_N_2 157 326 1.4e-47 PFAM
Pfam:Peptidase_M24 328 544 7.2e-52 PFAM
Pfam:Peptidase_M24_C 555 619 7.3e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182500
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182534
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182877
Predicted Effect probably benign
Transcript: ENSMUST00000183108
AA Change: D286E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000138250
Gene: ENSMUSG00000025027
AA Change: D286E

DomainStartEndE-ValueType
Pfam:Creatinase_N 53 198 1.2e-17 PFAM
Pfam:Peptidase_M24 371 587 5.5e-49 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183188
Predicted Effect probably benign
Transcript: ENSMUST00000183274
AA Change: D286E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000138233
Gene: ENSMUSG00000025027
AA Change: D286E

DomainStartEndE-ValueType
Pfam:Creatinase_N 53 198 1.2e-17 PFAM
Pfam:Peptidase_M24 371 587 1.9e-48 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184510
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 92.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the cytosolic form of a metalloaminopeptidase that catalyzes the cleavage of the N-terminal amino acid adjacent to a proline residue. The gene product may play a role in degradation and maturation of tachykinins, neuropeptides, and peptide hormones. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit pre and postnatal lethality, reduced male survival, growth retardation with decreased body weight, size and length, microcephaly and peptiduria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb8 G T 5: 24,613,748 (GRCm39) A649S probably damaging Het
Adam6a T A 12: 113,508,835 (GRCm39) C403S probably damaging Het
Adgrg3 T C 8: 95,766,896 (GRCm39) F417S possibly damaging Het
Ago1 T C 4: 126,334,194 (GRCm39) E439G probably damaging Het
Alox15 A G 11: 70,240,458 (GRCm39) V241A possibly damaging Het
Arhgap6 A G X: 168,048,480 (GRCm39) H566R probably damaging Het
Asap1 A T 15: 64,024,701 (GRCm39) F345I probably benign Het
Atp1b2 A G 11: 69,493,678 (GRCm39) Y134H probably damaging Het
Atp8b3 G A 10: 80,368,376 (GRCm39) T199M probably damaging Het
Calb1 A T 4: 15,895,656 (GRCm39) S115C probably damaging Het
Ccdc68 A T 18: 70,073,192 (GRCm39) I47F probably damaging Het
Cdc42bpa A T 1: 179,921,540 (GRCm39) N560I probably benign Het
Cdhr3 T C 12: 33,092,370 (GRCm39) D747G probably benign Het
Cdk5rap1 T G 2: 154,194,171 (GRCm39) N378T probably damaging Het
Chil4 T G 3: 106,111,006 (GRCm39) N296T probably benign Het
Cryaa G A 17: 31,898,533 (GRCm39) V87I probably damaging Het
Csk G A 9: 57,538,225 (GRCm39) L28F probably damaging Het
Cspp1 A G 1: 10,156,122 (GRCm39) N444D possibly damaging Het
Cyp2j8 A G 4: 96,363,794 (GRCm39) Y290H probably benign Het
Eps8l1 A T 7: 4,480,448 (GRCm39) D563V probably damaging Het
Fam111a A T 19: 12,564,682 (GRCm39) S144C possibly damaging Het
Fam135a A T 1: 24,060,951 (GRCm39) S1145R probably damaging Het
Fpr2 T A 17: 18,113,856 (GRCm39) V284D possibly damaging Het
Furin A G 7: 80,048,340 (GRCm39) probably null Het
Gatd1 T C 7: 140,989,806 (GRCm39) T135A probably benign Het
Gdf3 A G 6: 122,586,724 (GRCm39) S68P probably benign Het
Gm6871 T C 7: 41,195,822 (GRCm39) H305R probably benign Het
Grip1 A G 10: 119,890,756 (GRCm39) S917G probably damaging Het
Hdac10 T A 15: 89,009,718 (GRCm39) E388V possibly damaging Het
Hectd1 T C 12: 51,820,661 (GRCm39) N1176S probably damaging Het
Hectd4 A G 5: 121,487,322 (GRCm39) D3439G probably benign Het
Kcna4 T C 2: 107,127,032 (GRCm39) Y589H probably benign Het
Kcnk5 A T 14: 20,192,462 (GRCm39) L233Q probably damaging Het
Kcnt1 T C 2: 25,790,397 (GRCm39) I453T probably damaging Het
Kifc3 A G 8: 95,833,170 (GRCm39) I440T possibly damaging Het
Krt10 C A 11: 99,276,806 (GRCm39) G40* probably null Het
Lce1i A T 3: 92,685,102 (GRCm39) C25S unknown Het
Met A G 6: 17,491,460 (GRCm39) N74S probably benign Het
Naa35 G A 13: 59,766,093 (GRCm39) probably null Het
Naalad2 T C 9: 18,289,965 (GRCm39) N221S probably benign Het
Nolc1 AGCG AGCGGCG 19: 46,069,814 (GRCm39) probably benign Het
Nsmf T C 2: 24,950,271 (GRCm39) V181A probably damaging Het
Nwd2 T A 5: 63,957,848 (GRCm39) S393T probably benign Het
Or12j3 T A 7: 139,952,951 (GRCm39) T191S probably damaging Het
Or2d3c A T 7: 106,526,201 (GRCm39) V155E possibly damaging Het
Or51a6 T A 7: 102,604,425 (GRCm39) I128L possibly damaging Het
Papola T A 12: 105,786,669 (GRCm39) S453R probably benign Het
Paqr9 A G 9: 95,442,262 (GRCm39) N84S probably damaging Het
Pde5a T C 3: 122,572,585 (GRCm39) V290A probably benign Het
Prf1 T C 10: 61,138,948 (GRCm39) V302A probably damaging Het
Psg18 T C 7: 18,087,406 (GRCm39) Y84C probably benign Het
Rasgrf2 C T 13: 92,038,783 (GRCm39) R1021H probably damaging Het
Rnf114 G T 2: 167,354,522 (GRCm39) R201L possibly damaging Het
Rp1l1 A G 14: 64,269,343 (GRCm39) E1643G probably benign Het
Scg3 T A 9: 75,576,586 (GRCm39) E263V probably null Het
Scn2a C T 2: 65,544,180 (GRCm39) R854* probably null Het
Setdb2 T C 14: 59,654,934 (GRCm39) K319E probably benign Het
Stub1 A T 17: 26,051,097 (GRCm39) V95E probably damaging Het
Tas2r140 T A 6: 133,032,471 (GRCm39) N96Y probably damaging Het
Tecta T A 9: 42,259,482 (GRCm39) D1467V probably damaging Het
Tenm3 T A 8: 48,689,456 (GRCm39) T2044S probably damaging Het
Tlr2 T A 3: 83,744,770 (GRCm39) M438L probably benign Het
Tmem179 T C 12: 112,471,094 (GRCm39) Y106C probably benign Het
Tspan7 A G X: 10,451,854 (GRCm39) H187R probably benign Het
Ttn T C 2: 76,757,619 (GRCm39) D3332G probably damaging Het
Upp2 T C 2: 58,680,152 (GRCm39) F326S probably damaging Het
Usp2 T A 9: 44,003,452 (GRCm39) D224E probably damaging Het
Vmn1r5 T A 6: 56,962,483 (GRCm39) F53I probably benign Het
Wapl T A 14: 34,451,147 (GRCm39) L727H probably damaging Het
Wipf1 T C 2: 73,267,870 (GRCm39) D176G possibly damaging Het
Zfp616 A T 11: 73,974,744 (GRCm39) I429F possibly damaging Het
Zfyve26 G A 12: 79,334,535 (GRCm39) P161L probably benign Het
Other mutations in Xpnpep1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:Xpnpep1 APN 19 52,998,579 (GRCm39) missense probably benign 0.06
IGL01665:Xpnpep1 APN 19 52,985,463 (GRCm39) missense probably benign 0.00
IGL01833:Xpnpep1 APN 19 52,988,824 (GRCm39) missense probably damaging 1.00
IGL02011:Xpnpep1 APN 19 52,990,896 (GRCm39) critical splice donor site probably benign 0.00
IGL03229:Xpnpep1 APN 19 53,013,811 (GRCm39) missense probably benign
IGL03334:Xpnpep1 APN 19 52,998,577 (GRCm39) missense probably damaging 1.00
R0226:Xpnpep1 UTSW 19 52,998,583 (GRCm39) missense probably benign 0.03
R0613:Xpnpep1 UTSW 19 52,994,784 (GRCm39) missense probably damaging 0.97
R0648:Xpnpep1 UTSW 19 52,986,294 (GRCm39) splice site probably benign
R1543:Xpnpep1 UTSW 19 52,980,107 (GRCm39) missense probably benign 0.24
R1801:Xpnpep1 UTSW 19 52,998,564 (GRCm39) missense probably damaging 1.00
R1853:Xpnpep1 UTSW 19 52,994,641 (GRCm39) missense probably benign 0.01
R2234:Xpnpep1 UTSW 19 53,001,892 (GRCm39) missense probably damaging 1.00
R3797:Xpnpep1 UTSW 19 52,994,773 (GRCm39) missense probably benign 0.28
R3820:Xpnpep1 UTSW 19 52,992,250 (GRCm39) splice site probably benign
R3822:Xpnpep1 UTSW 19 52,992,250 (GRCm39) splice site probably benign
R3925:Xpnpep1 UTSW 19 52,980,128 (GRCm39) missense probably damaging 1.00
R4831:Xpnpep1 UTSW 19 53,003,053 (GRCm39) missense probably benign 0.09
R5033:Xpnpep1 UTSW 19 52,994,606 (GRCm39) missense probably benign
R5184:Xpnpep1 UTSW 19 53,001,845 (GRCm39) missense probably benign 0.24
R5468:Xpnpep1 UTSW 19 52,983,950 (GRCm39) missense probably benign 0.01
R5573:Xpnpep1 UTSW 19 52,993,253 (GRCm39) missense probably damaging 1.00
R5876:Xpnpep1 UTSW 19 52,985,439 (GRCm39) missense probably damaging 1.00
R5929:Xpnpep1 UTSW 19 53,001,920 (GRCm39) missense probably damaging 1.00
R6454:Xpnpep1 UTSW 19 52,986,310 (GRCm39) missense possibly damaging 0.91
R6519:Xpnpep1 UTSW 19 53,000,275 (GRCm39) missense possibly damaging 0.90
R7095:Xpnpep1 UTSW 19 53,000,196 (GRCm39) critical splice donor site probably null
R7112:Xpnpep1 UTSW 19 52,998,538 (GRCm39) missense probably benign
R7412:Xpnpep1 UTSW 19 52,994,722 (GRCm39) missense probably benign
R8329:Xpnpep1 UTSW 19 52,990,903 (GRCm39) critical splice donor site probably null
R8431:Xpnpep1 UTSW 19 52,983,937 (GRCm39) missense probably benign 0.04
R9194:Xpnpep1 UTSW 19 53,000,289 (GRCm39) missense possibly damaging 0.68
R9342:Xpnpep1 UTSW 19 52,993,248 (GRCm39) missense probably benign 0.02
R9388:Xpnpep1 UTSW 19 52,993,233 (GRCm39) missense probably damaging 1.00
R9546:Xpnpep1 UTSW 19 52,990,959 (GRCm39) missense probably damaging 1.00
R9746:Xpnpep1 UTSW 19 53,001,892 (GRCm39) missense probably damaging 1.00
RF017:Xpnpep1 UTSW 19 53,020,491 (GRCm39) missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- AGAGTTTACAGAGCCTCATCCGCC -3'
(R):5'- TGTAAGTGTGGGACCATCCCGTTAG -3'

Sequencing Primer
(F):5'- AAAGCCCAGATCTCTGTTTCAG -3'
(R):5'- CATCCCGTTAGGAGCTGTC -3'
Posted On 2014-04-13