Incidental Mutation 'R1554:Pfkfb2'
ID 170131
Institutional Source Beutler Lab
Gene Symbol Pfkfb2
Ensembl Gene ENSMUSG00000026409
Gene Name 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2
Synonyms 4930568D07Rik, PFK-2/FBPase-2 gene B
MMRRC Submission 039593-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1554 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 130616919-130656990 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 130634209 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 156 (V156A)
Ref Sequence ENSEMBL: ENSMUSP00000140698 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050406] [ENSMUST00000066863] [ENSMUST00000169659] [ENSMUST00000171479] [ENSMUST00000185233] [ENSMUST00000186777] [ENSMUST00000186867] [ENSMUST00000189534] [ENSMUST00000189167] [ENSMUST00000191301] [ENSMUST00000191347] [ENSMUST00000187089] [ENSMUST00000188520]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000050406
AA Change: V156A

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000133073
Gene: ENSMUSG00000026409
AA Change: V156A

DomainStartEndE-ValueType
Pfam:6PF2K 28 251 8.1e-107 PFAM
Pfam:KTI12 40 206 9.6e-8 PFAM
Pfam:AAA_33 42 198 3.1e-9 PFAM
PGAM 253 400 3.82e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000066863
AA Change: V156A

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000066426
Gene: ENSMUSG00000026409
AA Change: V156A

DomainStartEndE-ValueType
Pfam:6PF2K 28 251 1.2e-106 PFAM
Pfam:KTI12 41 207 3.5e-8 PFAM
Pfam:AAA_33 42 199 1.2e-10 PFAM
PGAM 253 400 3.82e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000169659
AA Change: V156A

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000127587
Gene: ENSMUSG00000026409
AA Change: V156A

DomainStartEndE-ValueType
Pfam:6PF2K 28 251 1.3e-106 PFAM
Pfam:KTI12 41 207 4.3e-8 PFAM
Pfam:AAA_33 42 199 1.2e-10 PFAM
PGAM 253 400 3.82e-16 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000171479
AA Change: V156A

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000129747
Gene: ENSMUSG00000026409
AA Change: V156A

DomainStartEndE-ValueType
Pfam:6PF2K 28 251 1.2e-106 PFAM
Pfam:KTI12 41 208 3.7e-8 PFAM
Pfam:AAA_33 42 199 1.1e-10 PFAM
PGAM 253 400 3.82e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000185233
AA Change: V156A

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000140551
Gene: ENSMUSG00000026409
AA Change: V156A

DomainStartEndE-ValueType
Pfam:6PF2K 28 251 1.2e-106 PFAM
Pfam:KTI12 41 207 3.5e-8 PFAM
Pfam:AAA_33 42 199 1.2e-10 PFAM
PGAM 253 400 3.82e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186777
Predicted Effect probably benign
Transcript: ENSMUST00000186867
Predicted Effect possibly damaging
Transcript: ENSMUST00000189534
AA Change: V156A

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000140355
Gene: ENSMUSG00000026409
AA Change: V156A

DomainStartEndE-ValueType
Pfam:6PF2K 28 251 1.2e-106 PFAM
Pfam:KTI12 41 208 3.7e-8 PFAM
Pfam:AAA_33 42 199 1.1e-10 PFAM
PGAM 253 400 3.82e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000189167
AA Change: V156A

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000140984
Gene: ENSMUSG00000026409
AA Change: V156A

DomainStartEndE-ValueType
Pfam:6PF2K 28 251 6.3e-107 PFAM
Pfam:KTI12 41 209 2.3e-8 PFAM
Pfam:AAA_33 42 199 6.4e-11 PFAM
PGAM 253 342 1.31e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000191301
AA Change: V156A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140995
Gene: ENSMUSG00000026409
AA Change: V156A

DomainStartEndE-ValueType
Pfam:6PF2K 28 181 9.5e-70 PFAM
Pfam:KTI12 41 183 3.2e-8 PFAM
Pfam:AAA_33 42 184 1.1e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000191347
AA Change: V156A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140698
Gene: ENSMUSG00000026409
AA Change: V156A

DomainStartEndE-ValueType
Pfam:6PF2K 28 251 1.2e-103 PFAM
Pfam:KTI12 41 207 2.4e-5 PFAM
Pfam:AAA_33 42 199 1.6e-8 PFAM
PGAM 253 400 2.9e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000187089
AA Change: V156A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140612
Gene: ENSMUSG00000026409
AA Change: V156A

DomainStartEndE-ValueType
Pfam:6PF2K 28 251 1e-103 PFAM
Pfam:KTI12 41 207 2.3e-5 PFAM
Pfam:AAA_33 42 199 1.4e-8 PFAM
PGAM 253 400 2.9e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000188520
AA Change: V156A

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000140786
Gene: ENSMUSG00000101904
AA Change: V156A

DomainStartEndE-ValueType
Pfam:6PF2K 28 251 6.3e-107 PFAM
Pfam:KTI12 41 209 2.3e-8 PFAM
Pfam:AAA_33 42 199 6.4e-11 PFAM
PGAM 253 342 1.31e-5 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 89.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in both the synthesis and degradation of fructose-2,6-bisphosphate, a regulatory molecule that controls glycolysis in eukaryotes. The encoded protein has a 6-phosphofructo-2-kinase activity that catalyzes the synthesis of fructose-2,6-bisphosphate, and a fructose-2,6-biphosphatase activity that catalyzes the degradation of fructose-2,6-bisphosphate. This protein regulates fructose-2,6-bisphosphate levels in the heart, while a related enzyme encoded by a different gene regulates fructose-2,6-bisphosphate levels in the liver and muscle. This enzyme functions as a homodimer. Two transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf T A 19: 31,886,302 (GRCm39) D70E possibly damaging Het
Adamts7 A T 9: 90,055,703 (GRCm39) D152V probably damaging Het
Api5 T C 2: 94,255,988 (GRCm39) D233G probably benign Het
Btaf1 A G 19: 36,973,998 (GRCm39) D1390G probably benign Het
Cep135 G A 5: 76,782,060 (GRCm39) W893* probably null Het
Cgas A T 9: 78,342,838 (GRCm39) S321R probably damaging Het
Cmtm6 T A 9: 114,575,550 (GRCm39) V153D possibly damaging Het
Dnah11 C T 12: 118,046,234 (GRCm39) V1735I possibly damaging Het
Dnm1l T C 16: 16,159,290 (GRCm39) N104S probably benign Het
Dpyd A T 3: 118,858,695 (GRCm39) probably null Het
Dtx1 T C 5: 120,821,386 (GRCm39) K387R probably damaging Het
Ercc4 A G 16: 12,965,486 (GRCm39) D706G probably damaging Het
Fat2 T C 11: 55,144,490 (GRCm39) N4128S probably benign Het
Gm42669 T A 5: 107,655,653 (GRCm39) C639S possibly damaging Het
Grk3 T A 5: 113,117,135 (GRCm39) I89L possibly damaging Het
Grm8 A T 6: 28,125,852 (GRCm39) D91E probably benign Het
Havcr1 C A 11: 46,643,334 (GRCm39) H85N probably benign Het
Il12rb1 G A 8: 71,266,016 (GRCm39) probably null Het
Kif3a A G 11: 53,489,154 (GRCm39) K117E probably damaging Het
Kitl T A 10: 99,923,300 (GRCm39) F15L probably benign Het
Ktn1 T G 14: 47,932,964 (GRCm39) L706R probably damaging Het
Lipg T C 18: 75,081,118 (GRCm39) Y321C probably damaging Het
Mapk8ip3 T C 17: 25,122,033 (GRCm39) D710G probably benign Het
Mchr1 A G 15: 81,120,021 (GRCm39) N16S probably benign Het
Myadml2 A T 11: 120,538,553 (GRCm39) L94* probably null Het
Npr3 C A 15: 11,848,649 (GRCm39) M439I probably benign Het
Obscn A G 11: 58,894,474 (GRCm39) I6677T unknown Het
Ogn A C 13: 49,774,520 (GRCm39) D221A probably benign Het
Or8b40 T C 9: 38,027,230 (GRCm39) I46T probably benign Het
Pard3b C A 1: 62,677,053 (GRCm39) Q1195K probably damaging Het
Pcsk4 T C 10: 80,157,785 (GRCm39) E608G probably benign Het
Pdlim1 T C 19: 40,211,516 (GRCm39) D259G probably benign Het
Per1 T C 11: 68,994,453 (GRCm39) S526P probably damaging Het
Ppp4r3a A T 12: 101,022,081 (GRCm39) D307E probably damaging Het
Rims4 T C 2: 163,721,042 (GRCm39) S70G probably damaging Het
Rnf213 T C 11: 119,332,665 (GRCm39) F2625L probably benign Het
Sap130 T C 18: 31,799,525 (GRCm39) L334P probably damaging Het
Slc16a10 T C 10: 39,952,796 (GRCm39) I233V probably benign Het
Slc16a7 A C 10: 125,066,791 (GRCm39) F283V possibly damaging Het
Slc25a24 T C 3: 109,043,586 (GRCm39) M81T probably benign Het
Slc30a9 A G 5: 67,484,264 (GRCm39) R134G probably damaging Het
Slc35d3 G T 10: 19,726,483 (GRCm39) L96M probably damaging Het
Slc7a11 C T 3: 50,336,345 (GRCm39) G333D probably damaging Het
Stam T C 2: 14,146,639 (GRCm39) S446P probably benign Het
Stk38 T A 17: 29,198,206 (GRCm39) N248I possibly damaging Het
Tasor2 A G 13: 3,626,374 (GRCm39) V1192A possibly damaging Het
Tle6 A C 10: 81,431,219 (GRCm39) S221A probably benign Het
Tmprss11b G A 5: 86,809,490 (GRCm39) T334I probably benign Het
Tmprss11c T A 5: 86,437,119 (GRCm39) M1L possibly damaging Het
Tpm1 T C 9: 66,930,711 (GRCm39) H262R probably benign Het
Tspan33 T C 6: 29,711,081 (GRCm39) S118P possibly damaging Het
Tyk2 A G 9: 21,019,218 (GRCm39) V1068A probably damaging Het
Ubr2 T C 17: 47,283,877 (GRCm39) I591V probably benign Het
Utp20 A T 10: 88,600,599 (GRCm39) Y38* probably null Het
Vmn1r217 A T 13: 23,298,464 (GRCm39) I146N possibly damaging Het
Zfp608 T C 18: 55,031,126 (GRCm39) Y938C probably damaging Het
Other mutations in Pfkfb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01990:Pfkfb2 APN 1 130,633,107 (GRCm39) splice site probably benign
IGL02273:Pfkfb2 APN 1 130,635,319 (GRCm39) missense probably damaging 1.00
IGL02369:Pfkfb2 APN 1 130,628,572 (GRCm39) missense probably damaging 0.99
IGL02469:Pfkfb2 APN 1 130,627,774 (GRCm39) missense probably damaging 1.00
IGL02490:Pfkfb2 APN 1 130,628,589 (GRCm39) missense probably damaging 1.00
R0080:Pfkfb2 UTSW 1 130,642,279 (GRCm39) missense probably benign 0.20
R0616:Pfkfb2 UTSW 1 130,634,159 (GRCm39) splice site probably null
R1458:Pfkfb2 UTSW 1 130,635,927 (GRCm39) missense possibly damaging 0.89
R1490:Pfkfb2 UTSW 1 130,625,626 (GRCm39) splice site probably null
R1548:Pfkfb2 UTSW 1 130,625,820 (GRCm39) missense probably benign
R2143:Pfkfb2 UTSW 1 130,626,460 (GRCm39) missense probably benign 0.00
R2144:Pfkfb2 UTSW 1 130,626,460 (GRCm39) missense probably benign 0.00
R2145:Pfkfb2 UTSW 1 130,626,460 (GRCm39) missense probably benign 0.00
R2212:Pfkfb2 UTSW 1 130,635,269 (GRCm39) missense probably damaging 1.00
R2938:Pfkfb2 UTSW 1 130,633,147 (GRCm39) missense possibly damaging 0.95
R4650:Pfkfb2 UTSW 1 130,633,200 (GRCm39) missense possibly damaging 0.67
R4683:Pfkfb2 UTSW 1 130,634,221 (GRCm39) critical splice acceptor site probably null
R5153:Pfkfb2 UTSW 1 130,629,527 (GRCm39) missense probably damaging 1.00
R5914:Pfkfb2 UTSW 1 130,627,832 (GRCm39) missense probably damaging 1.00
R5976:Pfkfb2 UTSW 1 130,635,816 (GRCm39) nonsense probably null
R6194:Pfkfb2 UTSW 1 130,625,624 (GRCm39) makesense probably null
R6285:Pfkfb2 UTSW 1 130,635,299 (GRCm39) nonsense probably null
R6956:Pfkfb2 UTSW 1 130,635,337 (GRCm39) missense probably damaging 1.00
R6971:Pfkfb2 UTSW 1 130,628,533 (GRCm39) missense probably damaging 1.00
R7723:Pfkfb2 UTSW 1 130,635,325 (GRCm39) missense probably damaging 1.00
R8475:Pfkfb2 UTSW 1 130,624,816 (GRCm39) missense probably benign
R8704:Pfkfb2 UTSW 1 130,625,780 (GRCm39) missense probably benign 0.12
R8846:Pfkfb2 UTSW 1 130,625,648 (GRCm39) missense probably benign
R8884:Pfkfb2 UTSW 1 130,634,213 (GRCm39) missense probably damaging 0.96
R9033:Pfkfb2 UTSW 1 130,626,475 (GRCm39) nonsense probably null
R9739:Pfkfb2 UTSW 1 130,624,815 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GACTCCCACAATCTAAGCTGTTCCC -3'
(R):5'- GTTCTGACTCCATGCTGGAGGAAG -3'

Sequencing Primer
(F):5'- TGTATTCCTCAAAGGCCCAG -3'
(R):5'- GTAGAACCTCTGACTCTGCTGAG -3'
Posted On 2014-04-13