Incidental Mutation 'R1554:Pfkfb2'
ID170131
Institutional Source Beutler Lab
Gene Symbol Pfkfb2
Ensembl Gene ENSMUSG00000026409
Gene Name6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2
Synonyms4930568D07Rik, PFK-2/FBPase-2 gene B
MMRRC Submission 039593-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1554 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location130689182-130729253 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 130706472 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 156 (V156A)
Ref Sequence ENSEMBL: ENSMUSP00000140698 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050406] [ENSMUST00000066863] [ENSMUST00000169659] [ENSMUST00000171479] [ENSMUST00000185233] [ENSMUST00000186777] [ENSMUST00000186867] [ENSMUST00000187089] [ENSMUST00000188520] [ENSMUST00000189167] [ENSMUST00000189534] [ENSMUST00000191301] [ENSMUST00000191347]
Predicted Effect probably damaging
Transcript: ENSMUST00000050406
AA Change: V156A

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000133073
Gene: ENSMUSG00000026409
AA Change: V156A

DomainStartEndE-ValueType
Pfam:6PF2K 28 251 8.1e-107 PFAM
Pfam:KTI12 40 206 9.6e-8 PFAM
Pfam:AAA_33 42 198 3.1e-9 PFAM
PGAM 253 400 3.82e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000066863
AA Change: V156A

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000066426
Gene: ENSMUSG00000026409
AA Change: V156A

DomainStartEndE-ValueType
Pfam:6PF2K 28 251 1.2e-106 PFAM
Pfam:KTI12 41 207 3.5e-8 PFAM
Pfam:AAA_33 42 199 1.2e-10 PFAM
PGAM 253 400 3.82e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000169659
AA Change: V156A

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000127587
Gene: ENSMUSG00000026409
AA Change: V156A

DomainStartEndE-ValueType
Pfam:6PF2K 28 251 1.3e-106 PFAM
Pfam:KTI12 41 207 4.3e-8 PFAM
Pfam:AAA_33 42 199 1.2e-10 PFAM
PGAM 253 400 3.82e-16 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000171479
AA Change: V156A

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000129747
Gene: ENSMUSG00000026409
AA Change: V156A

DomainStartEndE-ValueType
Pfam:6PF2K 28 251 1.2e-106 PFAM
Pfam:KTI12 41 208 3.7e-8 PFAM
Pfam:AAA_33 42 199 1.1e-10 PFAM
PGAM 253 400 3.82e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000185233
AA Change: V156A

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000140551
Gene: ENSMUSG00000026409
AA Change: V156A

DomainStartEndE-ValueType
Pfam:6PF2K 28 251 1.2e-106 PFAM
Pfam:KTI12 41 207 3.5e-8 PFAM
Pfam:AAA_33 42 199 1.2e-10 PFAM
PGAM 253 400 3.82e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186777
Predicted Effect probably benign
Transcript: ENSMUST00000186867
Predicted Effect probably damaging
Transcript: ENSMUST00000187089
AA Change: V156A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140612
Gene: ENSMUSG00000026409
AA Change: V156A

DomainStartEndE-ValueType
Pfam:6PF2K 28 251 1e-103 PFAM
Pfam:KTI12 41 207 2.3e-5 PFAM
Pfam:AAA_33 42 199 1.4e-8 PFAM
PGAM 253 400 2.9e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000188520
AA Change: V156A

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000140786
Gene: ENSMUSG00000101904
AA Change: V156A

DomainStartEndE-ValueType
Pfam:6PF2K 28 251 6.3e-107 PFAM
Pfam:KTI12 41 209 2.3e-8 PFAM
Pfam:AAA_33 42 199 6.4e-11 PFAM
PGAM 253 342 1.31e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000189167
AA Change: V156A

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000140984
Gene: ENSMUSG00000026409
AA Change: V156A

DomainStartEndE-ValueType
Pfam:6PF2K 28 251 6.3e-107 PFAM
Pfam:KTI12 41 209 2.3e-8 PFAM
Pfam:AAA_33 42 199 6.4e-11 PFAM
PGAM 253 342 1.31e-5 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000189534
AA Change: V156A

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000140355
Gene: ENSMUSG00000026409
AA Change: V156A

DomainStartEndE-ValueType
Pfam:6PF2K 28 251 1.2e-106 PFAM
Pfam:KTI12 41 208 3.7e-8 PFAM
Pfam:AAA_33 42 199 1.1e-10 PFAM
PGAM 253 400 3.82e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000191301
AA Change: V156A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140995
Gene: ENSMUSG00000026409
AA Change: V156A

DomainStartEndE-ValueType
Pfam:6PF2K 28 181 9.5e-70 PFAM
Pfam:KTI12 41 183 3.2e-8 PFAM
Pfam:AAA_33 42 184 1.1e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000191347
AA Change: V156A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140698
Gene: ENSMUSG00000026409
AA Change: V156A

DomainStartEndE-ValueType
Pfam:6PF2K 28 251 1.2e-103 PFAM
Pfam:KTI12 41 207 2.4e-5 PFAM
Pfam:AAA_33 42 199 1.6e-8 PFAM
PGAM 253 400 2.9e-20 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 89.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in both the synthesis and degradation of fructose-2,6-bisphosphate, a regulatory molecule that controls glycolysis in eukaryotes. The encoded protein has a 6-phosphofructo-2-kinase activity that catalyzes the synthesis of fructose-2,6-bisphosphate, and a fructose-2,6-biphosphatase activity that catalyzes the degradation of fructose-2,6-bisphosphate. This protein regulates fructose-2,6-bisphosphate levels in the heart, while a related enzyme encoded by a different gene regulates fructose-2,6-bisphosphate levels in the liver and muscle. This enzyme functions as a homodimer. Two transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf T A 19: 31,908,902 D70E possibly damaging Het
Adamts7 A T 9: 90,173,650 D152V probably damaging Het
Api5 T C 2: 94,425,643 D233G probably benign Het
Btaf1 A G 19: 36,996,598 D1390G probably benign Het
Cep135 G A 5: 76,634,213 W893* probably null Het
Cmtm6 T A 9: 114,746,482 V153D possibly damaging Het
Dnah11 C T 12: 118,082,499 V1735I possibly damaging Het
Dnm1l T C 16: 16,341,426 N104S probably benign Het
Dpyd A T 3: 119,065,046 probably null Het
Dtx1 T C 5: 120,683,321 K387R probably damaging Het
Ercc4 A G 16: 13,147,622 D706G probably damaging Het
Fam208b A G 13: 3,576,374 V1192A possibly damaging Het
Fat2 T C 11: 55,253,664 N4128S probably benign Het
Gm42669 T A 5: 107,507,787 C639S possibly damaging Het
Grk3 T A 5: 112,969,269 I89L possibly damaging Het
Grm8 A T 6: 28,125,853 D91E probably benign Het
Havcr1 C A 11: 46,752,507 H85N probably benign Het
Il12rb1 G A 8: 70,813,372 probably null Het
Kif3a A G 11: 53,598,327 K117E probably damaging Het
Kitl T A 10: 100,087,438 F15L probably benign Het
Ktn1 T G 14: 47,695,507 L706R probably damaging Het
Lipg T C 18: 74,948,047 Y321C probably damaging Het
Mapk8ip3 T C 17: 24,903,059 D710G probably benign Het
Mb21d1 A T 9: 78,435,556 S321R probably damaging Het
Mchr1 A G 15: 81,235,820 N16S probably benign Het
Myadml2 A T 11: 120,647,727 L94* probably null Het
Npr3 C A 15: 11,848,563 M439I probably benign Het
Obscn A G 11: 59,003,648 I6677T unknown Het
Ogn A C 13: 49,621,044 D221A probably benign Het
Olfr889 T C 9: 38,115,934 I46T probably benign Het
Pard3b C A 1: 62,637,894 Q1195K probably damaging Het
Pcsk4 T C 10: 80,321,951 E608G probably benign Het
Pdlim1 T C 19: 40,223,072 D259G probably benign Het
Per1 T C 11: 69,103,627 S526P probably damaging Het
Ppp4r3a A T 12: 101,055,822 D307E probably damaging Het
Rims4 T C 2: 163,879,122 S70G probably damaging Het
Rnf213 T C 11: 119,441,839 F2625L probably benign Het
Sap130 T C 18: 31,666,472 L334P probably damaging Het
Slc16a10 T C 10: 40,076,800 I233V probably benign Het
Slc16a7 A C 10: 125,230,922 F283V possibly damaging Het
Slc25a24 T C 3: 109,136,270 M81T probably benign Het
Slc30a9 A G 5: 67,326,921 R134G probably damaging Het
Slc35d3 G T 10: 19,850,737 L96M probably damaging Het
Slc7a11 C T 3: 50,381,896 G333D probably damaging Het
Stam T C 2: 14,141,828 S446P probably benign Het
Stk38 T A 17: 28,979,232 N248I possibly damaging Het
Tle6 A C 10: 81,595,385 S221A probably benign Het
Tmprss11b G A 5: 86,661,631 T334I probably benign Het
Tmprss11c T A 5: 86,289,260 M1L possibly damaging Het
Tpm1 T C 9: 67,023,429 H262R probably benign Het
Tspan33 T C 6: 29,711,082 S118P possibly damaging Het
Tyk2 A G 9: 21,107,922 V1068A probably damaging Het
Ubr2 T C 17: 46,972,951 I591V probably benign Het
Utp20 A T 10: 88,764,737 Y38* probably null Het
Vmn1r217 A T 13: 23,114,294 I146N possibly damaging Het
Zfp608 T C 18: 54,898,054 Y938C probably damaging Het
Other mutations in Pfkfb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01990:Pfkfb2 APN 1 130705370 splice site probably benign
IGL02273:Pfkfb2 APN 1 130707582 missense probably damaging 1.00
IGL02369:Pfkfb2 APN 1 130700835 missense probably damaging 0.99
IGL02469:Pfkfb2 APN 1 130700037 missense probably damaging 1.00
IGL02490:Pfkfb2 APN 1 130700852 missense probably damaging 1.00
R0080:Pfkfb2 UTSW 1 130714542 missense probably benign 0.20
R0616:Pfkfb2 UTSW 1 130706422 splice site probably null
R1458:Pfkfb2 UTSW 1 130708190 missense possibly damaging 0.89
R1490:Pfkfb2 UTSW 1 130697889 splice site probably null
R1548:Pfkfb2 UTSW 1 130698083 missense probably benign
R2143:Pfkfb2 UTSW 1 130698723 missense probably benign 0.00
R2144:Pfkfb2 UTSW 1 130698723 missense probably benign 0.00
R2145:Pfkfb2 UTSW 1 130698723 missense probably benign 0.00
R2212:Pfkfb2 UTSW 1 130707532 missense probably damaging 1.00
R2938:Pfkfb2 UTSW 1 130705410 missense possibly damaging 0.95
R4650:Pfkfb2 UTSW 1 130705463 missense possibly damaging 0.67
R4683:Pfkfb2 UTSW 1 130706484 critical splice acceptor site probably null
R5153:Pfkfb2 UTSW 1 130701790 missense probably damaging 1.00
R5914:Pfkfb2 UTSW 1 130700095 missense probably damaging 1.00
R5976:Pfkfb2 UTSW 1 130708079 nonsense probably null
R6194:Pfkfb2 UTSW 1 130697887 makesense probably null
R6285:Pfkfb2 UTSW 1 130707562 nonsense probably null
R6956:Pfkfb2 UTSW 1 130707600 missense probably damaging 1.00
R6971:Pfkfb2 UTSW 1 130700796 missense probably damaging 1.00
R7723:Pfkfb2 UTSW 1 130707588 missense probably damaging 1.00
R8475:Pfkfb2 UTSW 1 130697079 missense probably benign
R8704:Pfkfb2 UTSW 1 130698043 missense probably benign 0.12
R8846:Pfkfb2 UTSW 1 130697911 missense probably benign
Predicted Primers PCR Primer
(F):5'- GACTCCCACAATCTAAGCTGTTCCC -3'
(R):5'- GTTCTGACTCCATGCTGGAGGAAG -3'

Sequencing Primer
(F):5'- TGTATTCCTCAAAGGCCCAG -3'
(R):5'- GTAGAACCTCTGACTCTGCTGAG -3'
Posted On2014-04-13