Incidental Mutation 'R1554:Stam'
ID170132
Institutional Source Beutler Lab
Gene Symbol Stam
Ensembl Gene ENSMUSG00000026718
Gene Namesignal transducing adaptor molecule (SH3 domain and ITAM motif) 1
SynonymsSTAM1
MMRRC Submission 039593-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.419) question?
Stock #R1554 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location14074098-14149634 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 14141828 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 446 (S446P)
Ref Sequence ENSEMBL: ENSMUSP00000100025 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028050] [ENSMUST00000102960] [ENSMUST00000193636]
Predicted Effect probably benign
Transcript: ENSMUST00000028050
AA Change: S446P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000028050
Gene: ENSMUSG00000026718
AA Change: S446P

DomainStartEndE-ValueType
VHS 9 139 1.87e-63 SMART
UIM 171 190 1.6e-2 SMART
SH3 213 268 8.29e-23 SMART
PDB:3F1I|C 301 377 9e-46 PDB
low complexity region 387 404 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102960
AA Change: S446P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000100025
Gene: ENSMUSG00000026718
AA Change: S446P

DomainStartEndE-ValueType
VHS 9 139 1.87e-63 SMART
UIM 171 190 1.6e-2 SMART
SH3 213 268 8.29e-23 SMART
Pfam:GAT 304 377 6.8e-10 PFAM
low complexity region 387 404 N/A INTRINSIC
low complexity region 482 501 N/A INTRINSIC
low complexity region 533 540 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128777
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131734
Predicted Effect probably benign
Transcript: ENSMUST00000193636
SMART Domains Protein: ENSMUSP00000141207
Gene: ENSMUSG00000026718

DomainStartEndE-ValueType
Pfam:VHS 5 44 2e-8 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 89.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the signal-transducing adaptor molecule family. These proteins mediate downstream signaling of cytokine receptors and also play a role in ER to Golgi trafficking by interacting with the coat protein II complex. The encoded protein also associates with hepatocyte growth factor-regulated substrate to form the endosomal sorting complex required for transport-0 (ESCRT-0), which sorts ubiquitinated membrane proteins to the ESCRT-1 complex for lysosomal degradation. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit progressive growth retardation, priapism, male infertility, degeneration of hippocapal CA3 pyramidal neurons and premature death, but exhibit normal lymphocyte development, proliferation and responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf T A 19: 31,908,902 D70E possibly damaging Het
Adamts7 A T 9: 90,173,650 D152V probably damaging Het
Api5 T C 2: 94,425,643 D233G probably benign Het
Btaf1 A G 19: 36,996,598 D1390G probably benign Het
Cep135 G A 5: 76,634,213 W893* probably null Het
Cmtm6 T A 9: 114,746,482 V153D possibly damaging Het
Dnah11 C T 12: 118,082,499 V1735I possibly damaging Het
Dnm1l T C 16: 16,341,426 N104S probably benign Het
Dpyd A T 3: 119,065,046 probably null Het
Dtx1 T C 5: 120,683,321 K387R probably damaging Het
Ercc4 A G 16: 13,147,622 D706G probably damaging Het
Fam208b A G 13: 3,576,374 V1192A possibly damaging Het
Fat2 T C 11: 55,253,664 N4128S probably benign Het
Gm42669 T A 5: 107,507,787 C639S possibly damaging Het
Grk3 T A 5: 112,969,269 I89L possibly damaging Het
Grm8 A T 6: 28,125,853 D91E probably benign Het
Havcr1 C A 11: 46,752,507 H85N probably benign Het
Il12rb1 G A 8: 70,813,372 probably null Het
Kif3a A G 11: 53,598,327 K117E probably damaging Het
Kitl T A 10: 100,087,438 F15L probably benign Het
Ktn1 T G 14: 47,695,507 L706R probably damaging Het
Lipg T C 18: 74,948,047 Y321C probably damaging Het
Mapk8ip3 T C 17: 24,903,059 D710G probably benign Het
Mb21d1 A T 9: 78,435,556 S321R probably damaging Het
Mchr1 A G 15: 81,235,820 N16S probably benign Het
Myadml2 A T 11: 120,647,727 L94* probably null Het
Npr3 C A 15: 11,848,563 M439I probably benign Het
Obscn A G 11: 59,003,648 I6677T unknown Het
Ogn A C 13: 49,621,044 D221A probably benign Het
Olfr889 T C 9: 38,115,934 I46T probably benign Het
Pard3b C A 1: 62,637,894 Q1195K probably damaging Het
Pcsk4 T C 10: 80,321,951 E608G probably benign Het
Pdlim1 T C 19: 40,223,072 D259G probably benign Het
Per1 T C 11: 69,103,627 S526P probably damaging Het
Pfkfb2 A G 1: 130,706,472 V156A probably damaging Het
Ppp4r3a A T 12: 101,055,822 D307E probably damaging Het
Rims4 T C 2: 163,879,122 S70G probably damaging Het
Rnf213 T C 11: 119,441,839 F2625L probably benign Het
Sap130 T C 18: 31,666,472 L334P probably damaging Het
Slc16a10 T C 10: 40,076,800 I233V probably benign Het
Slc16a7 A C 10: 125,230,922 F283V possibly damaging Het
Slc25a24 T C 3: 109,136,270 M81T probably benign Het
Slc30a9 A G 5: 67,326,921 R134G probably damaging Het
Slc35d3 G T 10: 19,850,737 L96M probably damaging Het
Slc7a11 C T 3: 50,381,896 G333D probably damaging Het
Stk38 T A 17: 28,979,232 N248I possibly damaging Het
Tle6 A C 10: 81,595,385 S221A probably benign Het
Tmprss11b G A 5: 86,661,631 T334I probably benign Het
Tmprss11c T A 5: 86,289,260 M1L possibly damaging Het
Tpm1 T C 9: 67,023,429 H262R probably benign Het
Tspan33 T C 6: 29,711,082 S118P possibly damaging Het
Tyk2 A G 9: 21,107,922 V1068A probably damaging Het
Ubr2 T C 17: 46,972,951 I591V probably benign Het
Utp20 A T 10: 88,764,737 Y38* probably null Het
Vmn1r217 A T 13: 23,114,294 I146N possibly damaging Het
Zfp608 T C 18: 54,898,054 Y938C probably damaging Het
Other mutations in Stam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00972:Stam APN 2 14115968 intron probably benign
IGL02964:Stam APN 2 14115968 intron probably benign
IGL03365:Stam APN 2 14146390 nonsense probably null
R0058:Stam UTSW 2 14138141 missense probably damaging 1.00
R0410:Stam UTSW 2 14138991 missense probably benign 0.04
R0479:Stam UTSW 2 14117495 missense probably damaging 1.00
R1018:Stam UTSW 2 14117374 splice site probably benign
R1631:Stam UTSW 2 14146248 nonsense probably null
R1897:Stam UTSW 2 14129026 missense probably damaging 1.00
R3735:Stam UTSW 2 14129012 missense probably damaging 1.00
R3973:Stam UTSW 2 14138961 missense probably damaging 1.00
R4610:Stam UTSW 2 14115858 missense probably damaging 1.00
R4914:Stam UTSW 2 14102416 missense probably damaging 1.00
R5079:Stam UTSW 2 14074539 missense probably benign
R5209:Stam UTSW 2 14146347 missense probably benign 0.04
R5574:Stam UTSW 2 14115864 missense probably damaging 1.00
R5636:Stam UTSW 2 14117427 missense probably damaging 1.00
R6968:Stam UTSW 2 14116018 missense probably damaging 1.00
R7384:Stam UTSW 2 14134430 missense probably benign 0.17
R8127:Stam UTSW 2 14117473 missense probably damaging 0.99
R8687:Stam UTSW 2 14146280 utr 3 prime probably benign
R8687:Stam UTSW 2 14146285 utr 3 prime probably benign
Z1088:Stam UTSW 2 14139090 nonsense probably null
Z1176:Stam UTSW 2 14116013 missense probably damaging 1.00
Z1176:Stam UTSW 2 14128564 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TGTAACTGAATGCCTCTGCTGAGTAAC -3'
(R):5'- ACTTCACCCGTGTTCTTACAAAGCC -3'

Sequencing Primer
(F):5'- CCTCTGCTGAGTAACTTTGGAATATG -3'
(R):5'- GTGTTCTTACAAAGCCAACTCTAGAC -3'
Posted On2014-04-13