Incidental Mutation 'R1554:Tmprss11c'
ID170143
Institutional Source Beutler Lab
Gene Symbol Tmprss11c
Ensembl Gene ENSMUSG00000061184
Gene Nametransmembrane protease, serine 11c
Synonyms
MMRRC Submission 039593-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1554 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location86231481-86289308 bp(-) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) T to A at 86289260 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 1 (M1L)
Ref Sequence ENSEMBL: ENSMUSP00000142902 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059424] [ENSMUST00000196462]
Predicted Effect possibly damaging
Transcript: ENSMUST00000059424
AA Change: M1L

PolyPhen 2 Score 0.588 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000062915
Gene: ENSMUSG00000061184
AA Change: M1L

DomainStartEndE-ValueType
transmembrane domain 34 56 N/A INTRINSIC
SEA 58 183 5.19e-3 SMART
Tryp_SPc 199 425 8.42e-91 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000196462
AA Change: M1L

PolyPhen 2 Score 0.588 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000142902
Gene: ENSMUSG00000061184
AA Change: M1L

DomainStartEndE-ValueType
transmembrane domain 34 56 N/A INTRINSIC
SEA 58 176 3.6e-4 SMART
Tryp_SPc 186 412 4.1e-93 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 89.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf T A 19: 31,908,902 D70E possibly damaging Het
Adamts7 A T 9: 90,173,650 D152V probably damaging Het
Api5 T C 2: 94,425,643 D233G probably benign Het
Btaf1 A G 19: 36,996,598 D1390G probably benign Het
Cep135 G A 5: 76,634,213 W893* probably null Het
Cmtm6 T A 9: 114,746,482 V153D possibly damaging Het
Dnah11 C T 12: 118,082,499 V1735I possibly damaging Het
Dnm1l T C 16: 16,341,426 N104S probably benign Het
Dpyd A T 3: 119,065,046 probably null Het
Dtx1 T C 5: 120,683,321 K387R probably damaging Het
Ercc4 A G 16: 13,147,622 D706G probably damaging Het
Fam208b A G 13: 3,576,374 V1192A possibly damaging Het
Fat2 T C 11: 55,253,664 N4128S probably benign Het
Gm42669 T A 5: 107,507,787 C639S possibly damaging Het
Grk3 T A 5: 112,969,269 I89L possibly damaging Het
Grm8 A T 6: 28,125,853 D91E probably benign Het
Havcr1 C A 11: 46,752,507 H85N probably benign Het
Il12rb1 G A 8: 70,813,372 probably null Het
Kif3a A G 11: 53,598,327 K117E probably damaging Het
Kitl T A 10: 100,087,438 F15L probably benign Het
Ktn1 T G 14: 47,695,507 L706R probably damaging Het
Lipg T C 18: 74,948,047 Y321C probably damaging Het
Mapk8ip3 T C 17: 24,903,059 D710G probably benign Het
Mb21d1 A T 9: 78,435,556 S321R probably damaging Het
Mchr1 A G 15: 81,235,820 N16S probably benign Het
Myadml2 A T 11: 120,647,727 L94* probably null Het
Npr3 C A 15: 11,848,563 M439I probably benign Het
Obscn A G 11: 59,003,648 I6677T unknown Het
Ogn A C 13: 49,621,044 D221A probably benign Het
Olfr889 T C 9: 38,115,934 I46T probably benign Het
Pard3b C A 1: 62,637,894 Q1195K probably damaging Het
Pcsk4 T C 10: 80,321,951 E608G probably benign Het
Pdlim1 T C 19: 40,223,072 D259G probably benign Het
Per1 T C 11: 69,103,627 S526P probably damaging Het
Pfkfb2 A G 1: 130,706,472 V156A probably damaging Het
Ppp4r3a A T 12: 101,055,822 D307E probably damaging Het
Rims4 T C 2: 163,879,122 S70G probably damaging Het
Rnf213 T C 11: 119,441,839 F2625L probably benign Het
Sap130 T C 18: 31,666,472 L334P probably damaging Het
Slc16a10 T C 10: 40,076,800 I233V probably benign Het
Slc16a7 A C 10: 125,230,922 F283V possibly damaging Het
Slc25a24 T C 3: 109,136,270 M81T probably benign Het
Slc30a9 A G 5: 67,326,921 R134G probably damaging Het
Slc35d3 G T 10: 19,850,737 L96M probably damaging Het
Slc7a11 C T 3: 50,381,896 G333D probably damaging Het
Stam T C 2: 14,141,828 S446P probably benign Het
Stk38 T A 17: 28,979,232 N248I possibly damaging Het
Tle6 A C 10: 81,595,385 S221A probably benign Het
Tmprss11b G A 5: 86,661,631 T334I probably benign Het
Tpm1 T C 9: 67,023,429 H262R probably benign Het
Tspan33 T C 6: 29,711,082 S118P possibly damaging Het
Tyk2 A G 9: 21,107,922 V1068A probably damaging Het
Ubr2 T C 17: 46,972,951 I591V probably benign Het
Utp20 A T 10: 88,764,737 Y38* probably null Het
Vmn1r217 A T 13: 23,114,294 I146N possibly damaging Het
Zfp608 T C 18: 54,898,054 Y938C probably damaging Het
Other mutations in Tmprss11c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Tmprss11c APN 5 86239395 missense probably benign 0.00
IGL01357:Tmprss11c APN 5 86231807 missense probably damaging 1.00
IGL01809:Tmprss11c APN 5 86237662 missense possibly damaging 0.89
IGL02972:Tmprss11c APN 5 86237833 missense possibly damaging 0.77
IGL03135:Tmprss11c APN 5 86237650 missense probably damaging 1.00
IGL03255:Tmprss11c APN 5 86271482 missense probably damaging 0.99
IGL03355:Tmprss11c APN 5 86231871 missense probably benign 0.03
R0165:Tmprss11c UTSW 5 86231927 splice site probably benign
R0285:Tmprss11c UTSW 5 86271430 missense probably damaging 1.00
R0480:Tmprss11c UTSW 5 86237609 splice site probably benign
R0639:Tmprss11c UTSW 5 86235469 missense probably damaging 1.00
R1651:Tmprss11c UTSW 5 86239424 missense probably damaging 1.00
R2234:Tmprss11c UTSW 5 86282086 missense probably benign 0.12
R2235:Tmprss11c UTSW 5 86282086 missense probably benign 0.12
R2698:Tmprss11c UTSW 5 86271463 missense probably damaging 1.00
R4787:Tmprss11c UTSW 5 86256453 missense probably benign 0.00
R4962:Tmprss11c UTSW 5 86237710 missense probably damaging 1.00
R5063:Tmprss11c UTSW 5 86237830 missense probably benign 0.28
R5217:Tmprss11c UTSW 5 86256390 missense probably benign
R5366:Tmprss11c UTSW 5 86282134 missense possibly damaging 0.93
R6343:Tmprss11c UTSW 5 86256345 missense probably damaging 1.00
R6598:Tmprss11c UTSW 5 86289233 missense probably benign 0.01
R6681:Tmprss11c UTSW 5 86289260 start codon destroyed possibly damaging 0.59
R7170:Tmprss11c UTSW 5 86237619 critical splice donor site probably null
R7198:Tmprss11c UTSW 5 86231832 missense probably damaging 1.00
R7258:Tmprss11c UTSW 5 86271413 missense probably damaging 1.00
R7382:Tmprss11c UTSW 5 86231864 missense probably benign 0.19
R7391:Tmprss11c UTSW 5 86237791 missense probably damaging 1.00
R7590:Tmprss11c UTSW 5 86239473 missense probably benign 0.01
R7894:Tmprss11c UTSW 5 86231796 missense probably damaging 1.00
R8164:Tmprss11c UTSW 5 86231853 missense probably damaging 1.00
R8311:Tmprss11c UTSW 5 86235553 missense probably damaging 1.00
R8416:Tmprss11c UTSW 5 86239417 missense probably damaging 1.00
R8426:Tmprss11c UTSW 5 86231818 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCGAAAACGCTTCCATTGTAAC -3'
(R):5'- TGGATTGGCATACACACAGCTCCC -3'

Sequencing Primer
(F):5'- GGTCCTATTTCCATAGGAGATGAAAG -3'
(R):5'- ACACAGCTCCCAGTTTACTAATG -3'
Posted On2014-04-13