Incidental Mutation 'R1554:Grk3'
ID170146
Institutional Source Beutler Lab
Gene Symbol Grk3
Ensembl Gene ENSMUSG00000042249
Gene NameG protein-coupled receptor kinase 3
Synonyms4833444A01Rik, Bark-2, Adrbk-2, Adrbk2, beta ARK2
MMRRC Submission 039593-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1554 (G1)
Quality Score194
Status Not validated
Chromosome5
Chromosomal Location112910482-113015791 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 112969269 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 89 (I89L)
Ref Sequence ENSEMBL: ENSMUSP00000143427 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065167] [ENSMUST00000197776] [ENSMUST00000197888] [ENSMUST00000200332]
Predicted Effect probably benign
Transcript: ENSMUST00000065167
AA Change: I89L

PolyPhen 2 Score 0.186 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000070445
Gene: ENSMUSG00000042249
AA Change: I89L

DomainStartEndE-ValueType
RGS 54 175 1.44e-28 SMART
S_TKc 191 453 8.94e-85 SMART
S_TK_X 454 530 2.19e-10 SMART
PH 559 654 8.45e-12 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000197776
AA Change: I89L

PolyPhen 2 Score 0.761 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000143427
Gene: ENSMUSG00000042249
AA Change: I89L

DomainStartEndE-ValueType
RGS 54 170 7.71e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000197888
AA Change: I47L

PolyPhen 2 Score 0.212 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000142968
Gene: ENSMUSG00000042249
AA Change: I47L

DomainStartEndE-ValueType
RGS 12 133 1.44e-28 SMART
S_TKc 149 411 8.94e-85 SMART
S_TK_X 412 488 2.19e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200332
SMART Domains Protein: ENSMUSP00000142926
Gene: ENSMUSG00000042249

DomainStartEndE-ValueType
PDB:3V5W|A 1 88 6e-42 PDB
SCOP:d1dk8a_ 48 88 2e-4 SMART
Blast:RGS 54 88 1e-18 BLAST
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 89.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The beta-adrenergic receptor kinase specifically phosphorylates the agonist-occupied form of the beta-adrenergic and related G protein-coupled receptors. Overall, the beta adrenergic receptor kinase 2 has 85% amino acid similarity with beta adrenergic receptor kinase 1, with the protein kinase catalytic domain having 95% similarity. These data suggest the existence of a family of receptor kinases which may serve broadly to regulate receptor function. [provided by RefSeq, Jul 2008]
PHENOTYPE: Animals homozygous for a mutation of this gene appear normal and are fertile, but exhibit a lack of odorant receptor-mediated desensitization in the olfactory epithelium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf T A 19: 31,908,902 D70E possibly damaging Het
Adamts7 A T 9: 90,173,650 D152V probably damaging Het
Api5 T C 2: 94,425,643 D233G probably benign Het
Btaf1 A G 19: 36,996,598 D1390G probably benign Het
Cep135 G A 5: 76,634,213 W893* probably null Het
Cmtm6 T A 9: 114,746,482 V153D possibly damaging Het
Dnah11 C T 12: 118,082,499 V1735I possibly damaging Het
Dnm1l T C 16: 16,341,426 N104S probably benign Het
Dpyd A T 3: 119,065,046 probably null Het
Dtx1 T C 5: 120,683,321 K387R probably damaging Het
Ercc4 A G 16: 13,147,622 D706G probably damaging Het
Fam208b A G 13: 3,576,374 V1192A possibly damaging Het
Fat2 T C 11: 55,253,664 N4128S probably benign Het
Gm42669 T A 5: 107,507,787 C639S possibly damaging Het
Grm8 A T 6: 28,125,853 D91E probably benign Het
Havcr1 C A 11: 46,752,507 H85N probably benign Het
Il12rb1 G A 8: 70,813,372 probably null Het
Kif3a A G 11: 53,598,327 K117E probably damaging Het
Kitl T A 10: 100,087,438 F15L probably benign Het
Ktn1 T G 14: 47,695,507 L706R probably damaging Het
Lipg T C 18: 74,948,047 Y321C probably damaging Het
Mapk8ip3 T C 17: 24,903,059 D710G probably benign Het
Mb21d1 A T 9: 78,435,556 S321R probably damaging Het
Mchr1 A G 15: 81,235,820 N16S probably benign Het
Myadml2 A T 11: 120,647,727 L94* probably null Het
Npr3 C A 15: 11,848,563 M439I probably benign Het
Obscn A G 11: 59,003,648 I6677T unknown Het
Ogn A C 13: 49,621,044 D221A probably benign Het
Olfr889 T C 9: 38,115,934 I46T probably benign Het
Pard3b C A 1: 62,637,894 Q1195K probably damaging Het
Pcsk4 T C 10: 80,321,951 E608G probably benign Het
Pdlim1 T C 19: 40,223,072 D259G probably benign Het
Per1 T C 11: 69,103,627 S526P probably damaging Het
Pfkfb2 A G 1: 130,706,472 V156A probably damaging Het
Ppp4r3a A T 12: 101,055,822 D307E probably damaging Het
Rims4 T C 2: 163,879,122 S70G probably damaging Het
Rnf213 T C 11: 119,441,839 F2625L probably benign Het
Sap130 T C 18: 31,666,472 L334P probably damaging Het
Slc16a10 T C 10: 40,076,800 I233V probably benign Het
Slc16a7 A C 10: 125,230,922 F283V possibly damaging Het
Slc25a24 T C 3: 109,136,270 M81T probably benign Het
Slc30a9 A G 5: 67,326,921 R134G probably damaging Het
Slc35d3 G T 10: 19,850,737 L96M probably damaging Het
Slc7a11 C T 3: 50,381,896 G333D probably damaging Het
Stam T C 2: 14,141,828 S446P probably benign Het
Stk38 T A 17: 28,979,232 N248I possibly damaging Het
Tle6 A C 10: 81,595,385 S221A probably benign Het
Tmprss11b G A 5: 86,661,631 T334I probably benign Het
Tmprss11c T A 5: 86,289,260 M1L possibly damaging Het
Tpm1 T C 9: 67,023,429 H262R probably benign Het
Tspan33 T C 6: 29,711,082 S118P possibly damaging Het
Tyk2 A G 9: 21,107,922 V1068A probably damaging Het
Ubr2 T C 17: 46,972,951 I591V probably benign Het
Utp20 A T 10: 88,764,737 Y38* probably null Het
Vmn1r217 A T 13: 23,114,294 I146N possibly damaging Het
Zfp608 T C 18: 54,898,054 Y938C probably damaging Het
Other mutations in Grk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00974:Grk3 APN 5 112985819 missense probably damaging 1.00
IGL01359:Grk3 APN 5 112937760 missense probably damaging 1.00
IGL02318:Grk3 APN 5 112937803 missense probably damaging 1.00
IGL02612:Grk3 APN 5 112969234 missense probably benign 0.27
R0142:Grk3 UTSW 5 112915053 missense probably damaging 1.00
R0589:Grk3 UTSW 5 112928763 splice site probably benign
R0607:Grk3 UTSW 5 112920053 missense probably damaging 1.00
R1459:Grk3 UTSW 5 112915012 missense probably benign 0.10
R1640:Grk3 UTSW 5 113015382 missense probably benign 0.36
R1657:Grk3 UTSW 5 112966982 missense probably damaging 1.00
R1789:Grk3 UTSW 5 112941718 missense probably damaging 1.00
R2401:Grk3 UTSW 5 112914983 missense probably benign
R3735:Grk3 UTSW 5 112953831 missense probably benign 0.00
R4024:Grk3 UTSW 5 112914984 missense possibly damaging 0.77
R4025:Grk3 UTSW 5 112914984 missense possibly damaging 0.77
R4392:Grk3 UTSW 5 112920136 missense probably damaging 1.00
R4439:Grk3 UTSW 5 112946677 splice site probably null
R4589:Grk3 UTSW 5 112941718 missense possibly damaging 0.87
R4646:Grk3 UTSW 5 112929720 missense probably benign 0.04
R5154:Grk3 UTSW 5 112941717 missense probably damaging 1.00
R5462:Grk3 UTSW 5 112969208 missense probably damaging 1.00
R5764:Grk3 UTSW 5 112966910 critical splice donor site probably null
R5790:Grk3 UTSW 5 112966976 missense possibly damaging 0.80
R6516:Grk3 UTSW 5 112961549 intron probably benign
R6848:Grk3 UTSW 5 112985775 missense probably damaging 0.98
R7857:Grk3 UTSW 5 112961561 missense unknown
R7873:Grk3 UTSW 5 112929686 missense probably benign 0.03
R8029:Grk3 UTSW 5 112961642 missense probably benign
R8132:Grk3 UTSW 5 112961489 missense unknown
R8903:Grk3 UTSW 5 112918831 missense possibly damaging 0.89
RF021:Grk3 UTSW 5 112941688 missense probably benign 0.20
Z1176:Grk3 UTSW 5 112957314 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ACCACCATCAGGGTGTCAGTGTTAG -3'
(R):5'- AAATGCTCAGGGTCATCATGGAAGG -3'

Sequencing Primer
(F):5'- GAAACTgttgaagatcagcctg -3'
(R):5'- AGGAAATCCACTTGTGGTTCTAGC -3'
Posted On2014-04-13