Incidental Mutation 'R1554:Dtx1'
ID 170147
Institutional Source Beutler Lab
Gene Symbol Dtx1
Ensembl Gene ENSMUSG00000029603
Gene Name deltex 1, E3 ubiquitin ligase
Synonyms Fxit1
MMRRC Submission 039593-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1554 (G1)
Quality Score 201
Status Not validated
Chromosome 5
Chromosomal Location 120818267-120849992 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 120821386 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 387 (K387R)
Ref Sequence ENSEMBL: ENSMUSP00000031607 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031606] [ENSMUST00000031607] [ENSMUST00000156722]
AlphaFold Q61010
Predicted Effect probably benign
Transcript: ENSMUST00000031606
SMART Domains Protein: ENSMUSP00000031606
Gene: ENSMUSG00000029602

DomainStartEndE-ValueType
C2 6 113 7.74e-13 SMART
C2 134 231 2e-15 SMART
RasGAP 241 604 3.96e-166 SMART
PH 566 674 2.76e-16 SMART
BTK 674 710 2.24e-4 SMART
low complexity region 731 745 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000031607
AA Change: K387R

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000031607
Gene: ENSMUSG00000029603
AA Change: K387R

DomainStartEndE-ValueType
WWE 23 102 1.29e-38 SMART
WWE 104 179 3.88e-33 SMART
low complexity region 226 251 N/A INTRINSIC
low complexity region 258 290 N/A INTRINSIC
low complexity region 367 384 N/A INTRINSIC
low complexity region 387 397 N/A INTRINSIC
RING 418 478 5.82e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144889
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145174
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151562
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154759
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201264
Predicted Effect probably benign
Transcript: ENSMUST00000156722
SMART Domains Protein: ENSMUSP00000123266
Gene: ENSMUSG00000029602

DomainStartEndE-ValueType
C2 6 113 7.74e-13 SMART
C2 134 231 2e-15 SMART
RasGAP 241 604 3.96e-166 SMART
PH 566 674 2.76e-16 SMART
BTK 674 710 2.24e-4 SMART
low complexity region 731 745 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 89.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Studies in Drosophila have identified this gene as encoding a positive regulator of the Notch-signaling pathway. The human gene encodes a protein of unknown function; however, it may play a role in basic helix-loop-helix transcription factor activity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice are viable and fertile with normal B and T cell devlepment and function and no gross abnormalities in any of the major organs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf T A 19: 31,886,302 (GRCm39) D70E possibly damaging Het
Adamts7 A T 9: 90,055,703 (GRCm39) D152V probably damaging Het
Api5 T C 2: 94,255,988 (GRCm39) D233G probably benign Het
Btaf1 A G 19: 36,973,998 (GRCm39) D1390G probably benign Het
Cep135 G A 5: 76,782,060 (GRCm39) W893* probably null Het
Cgas A T 9: 78,342,838 (GRCm39) S321R probably damaging Het
Cmtm6 T A 9: 114,575,550 (GRCm39) V153D possibly damaging Het
Dnah11 C T 12: 118,046,234 (GRCm39) V1735I possibly damaging Het
Dnm1l T C 16: 16,159,290 (GRCm39) N104S probably benign Het
Dpyd A T 3: 118,858,695 (GRCm39) probably null Het
Ercc4 A G 16: 12,965,486 (GRCm39) D706G probably damaging Het
Fat2 T C 11: 55,144,490 (GRCm39) N4128S probably benign Het
Gm42669 T A 5: 107,655,653 (GRCm39) C639S possibly damaging Het
Grk3 T A 5: 113,117,135 (GRCm39) I89L possibly damaging Het
Grm8 A T 6: 28,125,852 (GRCm39) D91E probably benign Het
Havcr1 C A 11: 46,643,334 (GRCm39) H85N probably benign Het
Il12rb1 G A 8: 71,266,016 (GRCm39) probably null Het
Kif3a A G 11: 53,489,154 (GRCm39) K117E probably damaging Het
Kitl T A 10: 99,923,300 (GRCm39) F15L probably benign Het
Ktn1 T G 14: 47,932,964 (GRCm39) L706R probably damaging Het
Lipg T C 18: 75,081,118 (GRCm39) Y321C probably damaging Het
Mapk8ip3 T C 17: 25,122,033 (GRCm39) D710G probably benign Het
Mchr1 A G 15: 81,120,021 (GRCm39) N16S probably benign Het
Myadml2 A T 11: 120,538,553 (GRCm39) L94* probably null Het
Npr3 C A 15: 11,848,649 (GRCm39) M439I probably benign Het
Obscn A G 11: 58,894,474 (GRCm39) I6677T unknown Het
Ogn A C 13: 49,774,520 (GRCm39) D221A probably benign Het
Or8b40 T C 9: 38,027,230 (GRCm39) I46T probably benign Het
Pard3b C A 1: 62,677,053 (GRCm39) Q1195K probably damaging Het
Pcsk4 T C 10: 80,157,785 (GRCm39) E608G probably benign Het
Pdlim1 T C 19: 40,211,516 (GRCm39) D259G probably benign Het
Per1 T C 11: 68,994,453 (GRCm39) S526P probably damaging Het
Pfkfb2 A G 1: 130,634,209 (GRCm39) V156A probably damaging Het
Ppp4r3a A T 12: 101,022,081 (GRCm39) D307E probably damaging Het
Rims4 T C 2: 163,721,042 (GRCm39) S70G probably damaging Het
Rnf213 T C 11: 119,332,665 (GRCm39) F2625L probably benign Het
Sap130 T C 18: 31,799,525 (GRCm39) L334P probably damaging Het
Slc16a10 T C 10: 39,952,796 (GRCm39) I233V probably benign Het
Slc16a7 A C 10: 125,066,791 (GRCm39) F283V possibly damaging Het
Slc25a24 T C 3: 109,043,586 (GRCm39) M81T probably benign Het
Slc30a9 A G 5: 67,484,264 (GRCm39) R134G probably damaging Het
Slc35d3 G T 10: 19,726,483 (GRCm39) L96M probably damaging Het
Slc7a11 C T 3: 50,336,345 (GRCm39) G333D probably damaging Het
Stam T C 2: 14,146,639 (GRCm39) S446P probably benign Het
Stk38 T A 17: 29,198,206 (GRCm39) N248I possibly damaging Het
Tasor2 A G 13: 3,626,374 (GRCm39) V1192A possibly damaging Het
Tle6 A C 10: 81,431,219 (GRCm39) S221A probably benign Het
Tmprss11b G A 5: 86,809,490 (GRCm39) T334I probably benign Het
Tmprss11c T A 5: 86,437,119 (GRCm39) M1L possibly damaging Het
Tpm1 T C 9: 66,930,711 (GRCm39) H262R probably benign Het
Tspan33 T C 6: 29,711,081 (GRCm39) S118P possibly damaging Het
Tyk2 A G 9: 21,019,218 (GRCm39) V1068A probably damaging Het
Ubr2 T C 17: 47,283,877 (GRCm39) I591V probably benign Het
Utp20 A T 10: 88,600,599 (GRCm39) Y38* probably null Het
Vmn1r217 A T 13: 23,298,464 (GRCm39) I146N possibly damaging Het
Zfp608 T C 18: 55,031,126 (GRCm39) Y938C probably damaging Het
Other mutations in Dtx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02733:Dtx1 APN 5 120,819,500 (GRCm39) missense probably damaging 1.00
IGL03104:Dtx1 APN 5 120,833,030 (GRCm39) missense possibly damaging 0.77
IGL03139:Dtx1 APN 5 120,832,955 (GRCm39) missense probably damaging 0.96
R0094:Dtx1 UTSW 5 120,820,689 (GRCm39) missense probably damaging 1.00
R0173:Dtx1 UTSW 5 120,820,818 (GRCm39) unclassified probably benign
R0268:Dtx1 UTSW 5 120,819,356 (GRCm39) missense probably damaging 1.00
R0375:Dtx1 UTSW 5 120,819,464 (GRCm39) missense probably damaging 1.00
R0452:Dtx1 UTSW 5 120,833,057 (GRCm39) missense possibly damaging 0.94
R1109:Dtx1 UTSW 5 120,848,484 (GRCm39) start gained probably benign
R1456:Dtx1 UTSW 5 120,848,569 (GRCm39) utr 5 prime probably benign
R1541:Dtx1 UTSW 5 120,848,411 (GRCm39) start gained probably benign
R2042:Dtx1 UTSW 5 120,832,541 (GRCm39) missense probably benign 0.24
R2568:Dtx1 UTSW 5 120,848,249 (GRCm39) missense possibly damaging 0.84
R3946:Dtx1 UTSW 5 120,819,351 (GRCm39) missense possibly damaging 0.53
R4697:Dtx1 UTSW 5 120,832,473 (GRCm39) critical splice donor site probably null
R6150:Dtx1 UTSW 5 120,819,428 (GRCm39) missense probably damaging 1.00
R6564:Dtx1 UTSW 5 120,833,082 (GRCm39) missense probably benign 0.13
R6980:Dtx1 UTSW 5 120,819,422 (GRCm39) missense probably damaging 1.00
R7000:Dtx1 UTSW 5 120,833,148 (GRCm39) missense probably damaging 0.98
R7399:Dtx1 UTSW 5 120,820,458 (GRCm39) missense possibly damaging 0.60
R9117:Dtx1 UTSW 5 120,848,356 (GRCm39) missense probably benign
Z1176:Dtx1 UTSW 5 120,821,360 (GRCm39) missense probably benign
Z1177:Dtx1 UTSW 5 120,819,416 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGACAGGTGCGATGCTGTTAAAC -3'
(R):5'- TTTCTTCAGTGGGCAGGGGAAAC -3'

Sequencing Primer
(F):5'- GCGATGCTGTTAAACTTAAGCTCC -3'
(R):5'- GGCGTGGCTTCTCATGAC -3'
Posted On 2014-04-13