Incidental Mutation 'R1554:Olfr889'
ID170156
Institutional Source Beutler Lab
Gene Symbol Olfr889
Ensembl Gene ENSMUSG00000096356
Gene Nameolfactory receptor 889
SynonymsMOR162-2, GA_x6K02T2PVTD-31795028-31795957
MMRRC Submission 039593-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R1554 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location38115198-38121245 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 38115934 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 46 (I46T)
Ref Sequence ENSEMBL: ENSMUSP00000148913 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072290] [ENSMUST00000211851] [ENSMUST00000217286]
Predicted Effect probably benign
Transcript: ENSMUST00000072290
AA Change: I51T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000072137
Gene: ENSMUSG00000096356
AA Change: I51T

DomainStartEndE-ValueType
Pfam:7tm_4 36 311 4.4e-50 PFAM
Pfam:7tm_1 46 293 1e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000211851
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213042
AA Change: I46T
Predicted Effect probably benign
Transcript: ENSMUST00000217286
AA Change: I46T

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 89.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf T A 19: 31,908,902 D70E possibly damaging Het
Adamts7 A T 9: 90,173,650 D152V probably damaging Het
Api5 T C 2: 94,425,643 D233G probably benign Het
Btaf1 A G 19: 36,996,598 D1390G probably benign Het
Cep135 G A 5: 76,634,213 W893* probably null Het
Cmtm6 T A 9: 114,746,482 V153D possibly damaging Het
Dnah11 C T 12: 118,082,499 V1735I possibly damaging Het
Dnm1l T C 16: 16,341,426 N104S probably benign Het
Dpyd A T 3: 119,065,046 probably null Het
Dtx1 T C 5: 120,683,321 K387R probably damaging Het
Ercc4 A G 16: 13,147,622 D706G probably damaging Het
Fam208b A G 13: 3,576,374 V1192A possibly damaging Het
Fat2 T C 11: 55,253,664 N4128S probably benign Het
Gm42669 T A 5: 107,507,787 C639S possibly damaging Het
Grk3 T A 5: 112,969,269 I89L possibly damaging Het
Grm8 A T 6: 28,125,853 D91E probably benign Het
Havcr1 C A 11: 46,752,507 H85N probably benign Het
Il12rb1 G A 8: 70,813,372 probably null Het
Kif3a A G 11: 53,598,327 K117E probably damaging Het
Kitl T A 10: 100,087,438 F15L probably benign Het
Ktn1 T G 14: 47,695,507 L706R probably damaging Het
Lipg T C 18: 74,948,047 Y321C probably damaging Het
Mapk8ip3 T C 17: 24,903,059 D710G probably benign Het
Mb21d1 A T 9: 78,435,556 S321R probably damaging Het
Mchr1 A G 15: 81,235,820 N16S probably benign Het
Myadml2 A T 11: 120,647,727 L94* probably null Het
Npr3 C A 15: 11,848,563 M439I probably benign Het
Obscn A G 11: 59,003,648 I6677T unknown Het
Ogn A C 13: 49,621,044 D221A probably benign Het
Pard3b C A 1: 62,637,894 Q1195K probably damaging Het
Pcsk4 T C 10: 80,321,951 E608G probably benign Het
Pdlim1 T C 19: 40,223,072 D259G probably benign Het
Per1 T C 11: 69,103,627 S526P probably damaging Het
Pfkfb2 A G 1: 130,706,472 V156A probably damaging Het
Ppp4r3a A T 12: 101,055,822 D307E probably damaging Het
Rims4 T C 2: 163,879,122 S70G probably damaging Het
Rnf213 T C 11: 119,441,839 F2625L probably benign Het
Sap130 T C 18: 31,666,472 L334P probably damaging Het
Slc16a10 T C 10: 40,076,800 I233V probably benign Het
Slc16a7 A C 10: 125,230,922 F283V possibly damaging Het
Slc25a24 T C 3: 109,136,270 M81T probably benign Het
Slc30a9 A G 5: 67,326,921 R134G probably damaging Het
Slc35d3 G T 10: 19,850,737 L96M probably damaging Het
Slc7a11 C T 3: 50,381,896 G333D probably damaging Het
Stam T C 2: 14,141,828 S446P probably benign Het
Stk38 T A 17: 28,979,232 N248I possibly damaging Het
Tle6 A C 10: 81,595,385 S221A probably benign Het
Tmprss11b G A 5: 86,661,631 T334I probably benign Het
Tmprss11c T A 5: 86,289,260 M1L possibly damaging Het
Tpm1 T C 9: 67,023,429 H262R probably benign Het
Tspan33 T C 6: 29,711,082 S118P possibly damaging Het
Tyk2 A G 9: 21,107,922 V1068A probably damaging Het
Ubr2 T C 17: 46,972,951 I591V probably benign Het
Utp20 A T 10: 88,764,737 Y38* probably null Het
Vmn1r217 A T 13: 23,114,294 I146N possibly damaging Het
Zfp608 T C 18: 54,898,054 Y938C probably damaging Het
Other mutations in Olfr889
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02201:Olfr889 APN 9 38116597 missense probably benign 0.02
IGL02604:Olfr889 APN 9 38115852 nonsense probably null
IGL02727:Olfr889 APN 9 38116512 missense probably damaging 0.99
R0364:Olfr889 UTSW 9 38116029 missense probably benign 0.26
R0387:Olfr889 UTSW 9 38115770 splice site probably null
R0409:Olfr889 UTSW 9 38116251 missense probably benign
R0515:Olfr889 UTSW 9 38116017 missense probably damaging 1.00
R0693:Olfr889 UTSW 9 38116029 missense probably benign 0.26
R1972:Olfr889 UTSW 9 38116567 missense possibly damaging 0.79
R1973:Olfr889 UTSW 9 38116567 missense possibly damaging 0.79
R3815:Olfr889 UTSW 9 38116626 missense possibly damaging 0.94
R3816:Olfr889 UTSW 9 38116626 missense possibly damaging 0.94
R3817:Olfr889 UTSW 9 38116626 missense possibly damaging 0.94
R3819:Olfr889 UTSW 9 38116626 missense possibly damaging 0.94
R5532:Olfr889 UTSW 9 38116627 missense probably benign 0.12
R5775:Olfr889 UTSW 9 38116127 missense probably damaging 1.00
R5931:Olfr889 UTSW 9 38116374 missense probably benign 0.00
R6458:Olfr889 UTSW 9 38116054 missense possibly damaging 0.90
R6751:Olfr889 UTSW 9 38115975 missense probably damaging 1.00
R7168:Olfr889 UTSW 9 38116663 missense probably damaging 1.00
R7673:Olfr889 UTSW 9 38116227 missense probably benign 0.00
R7698:Olfr889 UTSW 9 38115892 nonsense probably null
R8432:Olfr889 UTSW 9 38115976 missense probably damaging 1.00
R9034:Olfr889 UTSW 9 38116254 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- AACCCAGTGAGCCTTTGGTGTG -3'
(R):5'- TGGGACATGGTGACCTGGTAAAGC -3'

Sequencing Primer
(F):5'- TTGAGATTACCACTGAGCCTG -3'
(R):5'- GCTTACAGATGGCAGCATATC -3'
Posted On2014-04-13