Incidental Mutation 'R1554:Tpm1'
ID170157
Institutional Source Beutler Lab
Gene Symbol Tpm1
Ensembl Gene ENSMUSG00000032366
Gene Nametropomyosin 1, alpha
SynonymsTM2, Tpm-1, alpha-TM, Tm3
MMRRC Submission 039593-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1554 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location67022590-67049406 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 67023429 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 262 (H262R)
Ref Sequence ENSEMBL: ENSMUSP00000109331 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034928] [ENSMUST00000050905] [ENSMUST00000113684] [ENSMUST00000113685] [ENSMUST00000113686] [ENSMUST00000113687] [ENSMUST00000113689] [ENSMUST00000113690] [ENSMUST00000113693] [ENSMUST00000113695] [ENSMUST00000113696] [ENSMUST00000113697] [ENSMUST00000113705] [ENSMUST00000113701] [ENSMUST00000113707] [ENSMUST00000139046] [ENSMUST00000129733]
Predicted Effect probably benign
Transcript: ENSMUST00000034928
AA Change: H304R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000034928
Gene: ENSMUSG00000032366
AA Change: H304R

DomainStartEndE-ValueType
low complexity region 20 35 N/A INTRINSIC
Pfam:Tropomyosin_1 56 195 4.1e-29 PFAM
Pfam:Tropomyosin 90 326 5.9e-97 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000050905
SMART Domains Protein: ENSMUSP00000051888
Gene: ENSMUSG00000032366

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 7 153 2.2e-39 PFAM
Pfam:Tropomyosin 48 284 5.1e-98 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113684
SMART Domains Protein: ENSMUSP00000109314
Gene: ENSMUSG00000032366

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 3 117 1.4e-22 PFAM
Pfam:Tropomyosin 12 248 8.1e-95 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113685
SMART Domains Protein: ENSMUSP00000109315
Gene: ENSMUSG00000032366

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 7 153 2.2e-39 PFAM
Pfam:Tropomyosin 48 284 3.1e-102 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113686
SMART Domains Protein: ENSMUSP00000109316
Gene: ENSMUSG00000032366

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 4 117 2.9e-23 PFAM
Pfam:Tropomyosin 12 228 8.4e-92 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113687
SMART Domains Protein: ENSMUSP00000109317
Gene: ENSMUSG00000032366

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 7 153 7.4e-40 PFAM
Pfam:Tropomyosin 48 264 1.8e-92 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113689
SMART Domains Protein: ENSMUSP00000109319
Gene: ENSMUSG00000032366

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 3 117 1.4e-22 PFAM
Pfam:Tropomyosin 12 244 8.8e-88 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113690
SMART Domains Protein: ENSMUSP00000109320
Gene: ENSMUSG00000032366

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 4 117 5.9e-23 PFAM
Pfam:Tropomyosin 12 244 8.3e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113693
SMART Domains Protein: ENSMUSP00000109323
Gene: ENSMUSG00000032366

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 7 153 6.1e-37 PFAM
Pfam:Tropomyosin 48 280 8.6e-93 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113695
AA Change: H226R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000109325
Gene: ENSMUSG00000032366
AA Change: H226R

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 4 117 6.1e-23 PFAM
Pfam:Tropomyosin 12 248 1.5e-97 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113696
AA Change: H226R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000109326
Gene: ENSMUSG00000032366
AA Change: H226R

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 4 117 6.1e-23 PFAM
Pfam:Tropomyosin 12 248 2.5e-93 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113697
AA Change: H262R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000109327
Gene: ENSMUSG00000032366
AA Change: H262R

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 7 153 2.2e-39 PFAM
Pfam:Tropomyosin 48 284 1.1e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113705
AA Change: H262R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000109335
Gene: ENSMUSG00000032366
AA Change: H262R

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 7 153 1.9e-31 PFAM
Pfam:Tropomyosin 48 284 9.5e-95 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113701
AA Change: H262R

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000109331
Gene: ENSMUSG00000032366
AA Change: H262R

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 7 153 1.9e-31 PFAM
Pfam:Tropomyosin 48 284 1.6e-90 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113707
AA Change: H262R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000109337
Gene: ENSMUSG00000032366
AA Change: H262R

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 7 153 2.2e-39 PFAM
Pfam:Tropomyosin 48 284 6.3e-99 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139046
Predicted Effect probably benign
Transcript: ENSMUST00000129733
SMART Domains Protein: ENSMUSP00000138784
Gene: ENSMUSG00000032366

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 7 153 4e-36 PFAM
Pfam:Tropomyosin 48 128 7.3e-27 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 89.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene display embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf T A 19: 31,908,902 D70E possibly damaging Het
Adamts7 A T 9: 90,173,650 D152V probably damaging Het
Api5 T C 2: 94,425,643 D233G probably benign Het
Btaf1 A G 19: 36,996,598 D1390G probably benign Het
Cep135 G A 5: 76,634,213 W893* probably null Het
Cmtm6 T A 9: 114,746,482 V153D possibly damaging Het
Dnah11 C T 12: 118,082,499 V1735I possibly damaging Het
Dnm1l T C 16: 16,341,426 N104S probably benign Het
Dpyd A T 3: 119,065,046 probably null Het
Dtx1 T C 5: 120,683,321 K387R probably damaging Het
Ercc4 A G 16: 13,147,622 D706G probably damaging Het
Fam208b A G 13: 3,576,374 V1192A possibly damaging Het
Fat2 T C 11: 55,253,664 N4128S probably benign Het
Gm42669 T A 5: 107,507,787 C639S possibly damaging Het
Grk3 T A 5: 112,969,269 I89L possibly damaging Het
Grm8 A T 6: 28,125,853 D91E probably benign Het
Havcr1 C A 11: 46,752,507 H85N probably benign Het
Il12rb1 G A 8: 70,813,372 probably null Het
Kif3a A G 11: 53,598,327 K117E probably damaging Het
Kitl T A 10: 100,087,438 F15L probably benign Het
Ktn1 T G 14: 47,695,507 L706R probably damaging Het
Lipg T C 18: 74,948,047 Y321C probably damaging Het
Mapk8ip3 T C 17: 24,903,059 D710G probably benign Het
Mb21d1 A T 9: 78,435,556 S321R probably damaging Het
Mchr1 A G 15: 81,235,820 N16S probably benign Het
Myadml2 A T 11: 120,647,727 L94* probably null Het
Npr3 C A 15: 11,848,563 M439I probably benign Het
Obscn A G 11: 59,003,648 I6677T unknown Het
Ogn A C 13: 49,621,044 D221A probably benign Het
Olfr889 T C 9: 38,115,934 I46T probably benign Het
Pard3b C A 1: 62,637,894 Q1195K probably damaging Het
Pcsk4 T C 10: 80,321,951 E608G probably benign Het
Pdlim1 T C 19: 40,223,072 D259G probably benign Het
Per1 T C 11: 69,103,627 S526P probably damaging Het
Pfkfb2 A G 1: 130,706,472 V156A probably damaging Het
Ppp4r3a A T 12: 101,055,822 D307E probably damaging Het
Rims4 T C 2: 163,879,122 S70G probably damaging Het
Rnf213 T C 11: 119,441,839 F2625L probably benign Het
Sap130 T C 18: 31,666,472 L334P probably damaging Het
Slc16a10 T C 10: 40,076,800 I233V probably benign Het
Slc16a7 A C 10: 125,230,922 F283V possibly damaging Het
Slc25a24 T C 3: 109,136,270 M81T probably benign Het
Slc30a9 A G 5: 67,326,921 R134G probably damaging Het
Slc35d3 G T 10: 19,850,737 L96M probably damaging Het
Slc7a11 C T 3: 50,381,896 G333D probably damaging Het
Stam T C 2: 14,141,828 S446P probably benign Het
Stk38 T A 17: 28,979,232 N248I possibly damaging Het
Tle6 A C 10: 81,595,385 S221A probably benign Het
Tmprss11b G A 5: 86,661,631 T334I probably benign Het
Tmprss11c T A 5: 86,289,260 M1L possibly damaging Het
Tspan33 T C 6: 29,711,082 S118P possibly damaging Het
Tyk2 A G 9: 21,107,922 V1068A probably damaging Het
Ubr2 T C 17: 46,972,951 I591V probably benign Het
Utp20 A T 10: 88,764,737 Y38* probably null Het
Vmn1r217 A T 13: 23,114,294 I146N possibly damaging Het
Zfp608 T C 18: 54,898,054 Y938C probably damaging Het
Other mutations in Tpm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01287:Tpm1 APN 9 67036055 missense probably damaging 1.00
IGL01288:Tpm1 APN 9 67036055 missense probably damaging 1.00
IGL01569:Tpm1 APN 9 67031108 splice site probably null
R1137:Tpm1 UTSW 9 67031118 splice site probably null
R2012:Tpm1 UTSW 9 67033965 nonsense probably null
R2898:Tpm1 UTSW 9 67031040 missense probably damaging 1.00
R3723:Tpm1 UTSW 9 67031945 intron probably benign
R3724:Tpm1 UTSW 9 67031945 intron probably benign
R4172:Tpm1 UTSW 9 67023367 missense probably benign 0.34
R4427:Tpm1 UTSW 9 67032565 intron probably benign
R4934:Tpm1 UTSW 9 67028049 splice site probably null
R5605:Tpm1 UTSW 9 67049035 missense probably damaging 0.99
R5726:Tpm1 UTSW 9 67023412 missense probably damaging 0.97
R6556:Tpm1 UTSW 9 67028169 critical splice acceptor site probably null
R6910:Tpm1 UTSW 9 67031974 missense probably damaging 1.00
R7242:Tpm1 UTSW 9 67028101 missense probably benign
R7386:Tpm1 UTSW 9 67028167 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGCTTCCTACACTGGCTAAGCAAAC -3'
(R):5'- AGTGGGTGAGCCTTCACCAAAC -3'

Sequencing Primer
(F):5'- CTCTATGAAGGGTGGCAACCTG -3'
(R):5'- CCTGCACTTTACGTCAGGG -3'
Posted On2014-04-13