Incidental Mutation 'R1554:Tle6'
ID170164
Institutional Source Beutler Lab
Gene Symbol Tle6
Ensembl Gene ENSMUSG00000034758
Gene Nametransducin-like enhancer of split 6
Synonyms1810057E06Rik, Grg6
MMRRC Submission 039593-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.304) question?
Stock #R1554 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location81590904-81601073 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 81595385 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 221 (S221A)
Ref Sequence ENSEMBL: ENSMUSP00000071905 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072020] [ENSMUST00000127546] [ENSMUST00000135211] [ENSMUST00000142948] [ENSMUST00000146916] [ENSMUST00000151858] [ENSMUST00000146358]
Predicted Effect probably benign
Transcript: ENSMUST00000072020
AA Change: S221A

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000071905
Gene: ENSMUSG00000034758
AA Change: S221A

DomainStartEndE-ValueType
WD40 283 320 9.6e-2 SMART
Blast:WD40 334 372 2e-12 BLAST
WD40 377 415 6.16e0 SMART
WD40 418 455 7.43e-1 SMART
Blast:WD40 460 496 4e-13 BLAST
WD40 499 538 1.43e0 SMART
WD40 541 578 2.97e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124724
Predicted Effect probably benign
Transcript: ENSMUST00000124854
SMART Domains Protein: ENSMUSP00000118334
Gene: ENSMUSG00000034771

DomainStartEndE-ValueType
Blast:WD40 6 44 9e-20 BLAST
WD40 46 85 1.2e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127546
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128278
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129282
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129798
Predicted Effect probably benign
Transcript: ENSMUST00000131411
SMART Domains Protein: ENSMUSP00000114400
Gene: ENSMUSG00000034771

DomainStartEndE-ValueType
WD40 36 75 1.2e-2 SMART
WD40 76 116 2.07e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131530
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134457
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135008
Predicted Effect probably benign
Transcript: ENSMUST00000135211
SMART Domains Protein: ENSMUSP00000117453
Gene: ENSMUSG00000034771

DomainStartEndE-ValueType
Pfam:TLE_N 1 122 3e-68 PFAM
low complexity region 133 160 N/A INTRINSIC
low complexity region 172 194 N/A INTRINSIC
low complexity region 262 277 N/A INTRINSIC
low complexity region 332 352 N/A INTRINSIC
WD40 436 473 5.6e-3 SMART
WD40 479 520 9.6e-2 SMART
WD40 525 564 1.88e-4 SMART
WD40 567 606 3.72e-8 SMART
Blast:WD40 609 647 8e-18 BLAST
WD40 649 688 1.2e-2 SMART
WD40 689 729 2.07e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142948
SMART Domains Protein: ENSMUSP00000117287
Gene: ENSMUSG00000034758

DomainStartEndE-ValueType
WD40 273 310 9.6e-2 SMART
Blast:WD40 324 362 2e-12 BLAST
WD40 367 405 6.16e0 SMART
WD40 408 445 7.43e-1 SMART
Blast:WD40 450 486 4e-13 BLAST
WD40 489 528 1.43e0 SMART
WD40 531 568 2.97e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137631
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153379
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139135
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136254
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140433
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146239
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149721
Predicted Effect probably benign
Transcript: ENSMUST00000146916
SMART Domains Protein: ENSMUSP00000121173
Gene: ENSMUSG00000034771

DomainStartEndE-ValueType
Pfam:TLE_N 1 134 1.6e-75 PFAM
low complexity region 144 171 N/A INTRINSIC
low complexity region 183 205 N/A INTRINSIC
low complexity region 273 288 N/A INTRINSIC
low complexity region 343 363 N/A INTRINSIC
WD40 435 472 5.6e-3 SMART
WD40 478 519 9.6e-2 SMART
WD40 524 563 1.88e-4 SMART
WD40 566 605 3.72e-8 SMART
WD40 648 687 1.2e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000151858
SMART Domains Protein: ENSMUSP00000119945
Gene: ENSMUSG00000034758

DomainStartEndE-ValueType
low complexity region 69 77 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146358
SMART Domains Protein: ENSMUSP00000121125
Gene: ENSMUSG00000034771

DomainStartEndE-ValueType
Pfam:TLE_N 1 64 2e-31 PFAM
Pfam:TLE_N 81 154 4.3e-34 PFAM
low complexity region 167 194 N/A INTRINSIC
low complexity region 206 228 N/A INTRINSIC
low complexity region 296 311 N/A INTRINSIC
low complexity region 366 386 N/A INTRINSIC
WD40 471 508 5.6e-3 SMART
WD40 514 555 9.6e-2 SMART
WD40 560 599 1.88e-4 SMART
WD40 602 641 3.72e-8 SMART
Blast:WD40 644 682 9e-18 BLAST
WD40 684 723 1.2e-2 SMART
WD40 724 764 2.07e-1 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 89.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Groucho/ transducin-like Enhancer of split family of transcriptional co-repressors. The encoded protein is a component of the mammalian subcortical maternal complex, which is required for preimplantation development. In mouse, knock out of this gene results in cleavage-stage embryonic arrest resulting from defective cytoplasmic F-actin meshwork formation and asymmetric cell division. In human, an allelic variant in this gene is associated with preimplantation embryonic lethality. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf T A 19: 31,908,902 D70E possibly damaging Het
Adamts7 A T 9: 90,173,650 D152V probably damaging Het
Api5 T C 2: 94,425,643 D233G probably benign Het
Btaf1 A G 19: 36,996,598 D1390G probably benign Het
Cep135 G A 5: 76,634,213 W893* probably null Het
Cmtm6 T A 9: 114,746,482 V153D possibly damaging Het
Dnah11 C T 12: 118,082,499 V1735I possibly damaging Het
Dnm1l T C 16: 16,341,426 N104S probably benign Het
Dpyd A T 3: 119,065,046 probably null Het
Dtx1 T C 5: 120,683,321 K387R probably damaging Het
Ercc4 A G 16: 13,147,622 D706G probably damaging Het
Fam208b A G 13: 3,576,374 V1192A possibly damaging Het
Fat2 T C 11: 55,253,664 N4128S probably benign Het
Gm42669 T A 5: 107,507,787 C639S possibly damaging Het
Grk3 T A 5: 112,969,269 I89L possibly damaging Het
Grm8 A T 6: 28,125,853 D91E probably benign Het
Havcr1 C A 11: 46,752,507 H85N probably benign Het
Il12rb1 G A 8: 70,813,372 probably null Het
Kif3a A G 11: 53,598,327 K117E probably damaging Het
Kitl T A 10: 100,087,438 F15L probably benign Het
Ktn1 T G 14: 47,695,507 L706R probably damaging Het
Lipg T C 18: 74,948,047 Y321C probably damaging Het
Mapk8ip3 T C 17: 24,903,059 D710G probably benign Het
Mb21d1 A T 9: 78,435,556 S321R probably damaging Het
Mchr1 A G 15: 81,235,820 N16S probably benign Het
Myadml2 A T 11: 120,647,727 L94* probably null Het
Npr3 C A 15: 11,848,563 M439I probably benign Het
Obscn A G 11: 59,003,648 I6677T unknown Het
Ogn A C 13: 49,621,044 D221A probably benign Het
Olfr889 T C 9: 38,115,934 I46T probably benign Het
Pard3b C A 1: 62,637,894 Q1195K probably damaging Het
Pcsk4 T C 10: 80,321,951 E608G probably benign Het
Pdlim1 T C 19: 40,223,072 D259G probably benign Het
Per1 T C 11: 69,103,627 S526P probably damaging Het
Pfkfb2 A G 1: 130,706,472 V156A probably damaging Het
Ppp4r3a A T 12: 101,055,822 D307E probably damaging Het
Rims4 T C 2: 163,879,122 S70G probably damaging Het
Rnf213 T C 11: 119,441,839 F2625L probably benign Het
Sap130 T C 18: 31,666,472 L334P probably damaging Het
Slc16a10 T C 10: 40,076,800 I233V probably benign Het
Slc16a7 A C 10: 125,230,922 F283V possibly damaging Het
Slc25a24 T C 3: 109,136,270 M81T probably benign Het
Slc30a9 A G 5: 67,326,921 R134G probably damaging Het
Slc35d3 G T 10: 19,850,737 L96M probably damaging Het
Slc7a11 C T 3: 50,381,896 G333D probably damaging Het
Stam T C 2: 14,141,828 S446P probably benign Het
Stk38 T A 17: 28,979,232 N248I possibly damaging Het
Tmprss11b G A 5: 86,661,631 T334I probably benign Het
Tmprss11c T A 5: 86,289,260 M1L possibly damaging Het
Tpm1 T C 9: 67,023,429 H262R probably benign Het
Tspan33 T C 6: 29,711,082 S118P possibly damaging Het
Tyk2 A G 9: 21,107,922 V1068A probably damaging Het
Ubr2 T C 17: 46,972,951 I591V probably benign Het
Utp20 A T 10: 88,764,737 Y38* probably null Het
Vmn1r217 A T 13: 23,114,294 I146N possibly damaging Het
Zfp608 T C 18: 54,898,054 Y938C probably damaging Het
Other mutations in Tle6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00966:Tle6 APN 10 81594458 missense probably damaging 1.00
IGL02151:Tle6 APN 10 81598640 missense probably benign 0.01
IGL02724:Tle6 APN 10 81600064 nonsense probably null
R0420:Tle6 UTSW 10 81595311 unclassified probably benign
R0423:Tle6 UTSW 10 81598623 missense possibly damaging 0.95
R0589:Tle6 UTSW 10 81595419 unclassified probably benign
R0605:Tle6 UTSW 10 81594346 missense probably damaging 0.99
R1860:Tle6 UTSW 10 81594329 missense probably damaging 1.00
R1863:Tle6 UTSW 10 81591921 missense possibly damaging 0.91
R1952:Tle6 UTSW 10 81595485 missense possibly damaging 0.82
R2139:Tle6 UTSW 10 81594034 missense probably damaging 0.99
R2337:Tle6 UTSW 10 81592656 splice site probably null
R2849:Tle6 UTSW 10 81594401 missense probably damaging 1.00
R3158:Tle6 UTSW 10 81595204 splice site probably null
R3777:Tle6 UTSW 10 81596153 missense probably benign 0.23
R3778:Tle6 UTSW 10 81596153 missense probably benign 0.23
R4085:Tle6 UTSW 10 81594515 splice site probably null
R5058:Tle6 UTSW 10 81594238 missense possibly damaging 0.93
R5058:Tle6 UTSW 10 81595957 missense probably damaging 1.00
R5183:Tle6 UTSW 10 81592801 missense probably damaging 0.97
R6225:Tle6 UTSW 10 81592766 missense probably damaging 1.00
R6331:Tle6 UTSW 10 81595239 missense probably benign 0.00
R6514:Tle6 UTSW 10 81591976 missense probably damaging 1.00
R6515:Tle6 UTSW 10 81591976 missense probably damaging 1.00
R6517:Tle6 UTSW 10 81591976 missense probably damaging 1.00
R7145:Tle6 UTSW 10 81600076 missense possibly damaging 0.66
R8070:Tle6 UTSW 10 81598642 missense possibly damaging 0.79
R8085:Tle6 UTSW 10 81595958 missense probably damaging 1.00
R8194:Tle6 UTSW 10 81591054 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CTTCCACCACCAGTTAAGGACATGG -3'
(R):5'- TCCCAGGAAAGCAAAGATTCAGGC -3'

Sequencing Primer
(F):5'- GTGAGGTAACCCCGCTTTC -3'
(R):5'- GCCTGTGTGACTTTAAACCAG -3'
Posted On2014-04-13