Incidental Mutation 'R1554:Utp20'
ID 170165
Institutional Source Beutler Lab
Gene Symbol Utp20
Ensembl Gene ENSMUSG00000004356
Gene Name UTP20 small subunit processome component
Synonyms 3830408P06Rik, DRIM, mDRIM
MMRRC Submission 039593-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.955) question?
Stock # R1554 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 88746607-88826804 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 88764737 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 38 (Y38*)
Ref Sequence ENSEMBL: ENSMUSP00000151748 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004470] [ENSMUST00000218967] [ENSMUST00000220188]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000004470
AA Change: Y1966*
SMART Domains Protein: ENSMUSP00000004470
Gene: ENSMUSG00000004356
AA Change: Y1966*

DomainStartEndE-ValueType
low complexity region 244 255 N/A INTRINSIC
low complexity region 442 454 N/A INTRINSIC
low complexity region 571 581 N/A INTRINSIC
low complexity region 695 704 N/A INTRINSIC
Pfam:DRIM 910 1534 2.6e-176 PFAM
low complexity region 1585 1598 N/A INTRINSIC
low complexity region 1705 1719 N/A INTRINSIC
low complexity region 2503 2513 N/A INTRINSIC
low complexity region 2589 2605 N/A INTRINSIC
low complexity region 2727 2737 N/A INTRINSIC
low complexity region 2746 2764 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000218967
AA Change: Y38*
Predicted Effect probably null
Transcript: ENSMUST00000220188
AA Change: Y38*
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 89.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] UTP20 is a component of the U3 small nucleolar RNA (snoRNA) (SNORD3A; MIM 180710) protein complex (U3 snoRNP) and is involved in 18S rRNA processing (Wang et al., 2007 [PubMed 17498821]).[supplied by OMIM, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf T A 19: 31,908,902 D70E possibly damaging Het
Adamts7 A T 9: 90,173,650 D152V probably damaging Het
Api5 T C 2: 94,425,643 D233G probably benign Het
Btaf1 A G 19: 36,996,598 D1390G probably benign Het
Cep135 G A 5: 76,634,213 W893* probably null Het
Cmtm6 T A 9: 114,746,482 V153D possibly damaging Het
Dnah11 C T 12: 118,082,499 V1735I possibly damaging Het
Dnm1l T C 16: 16,341,426 N104S probably benign Het
Dpyd A T 3: 119,065,046 probably null Het
Dtx1 T C 5: 120,683,321 K387R probably damaging Het
Ercc4 A G 16: 13,147,622 D706G probably damaging Het
Fam208b A G 13: 3,576,374 V1192A possibly damaging Het
Fat2 T C 11: 55,253,664 N4128S probably benign Het
Gm42669 T A 5: 107,507,787 C639S possibly damaging Het
Grk3 T A 5: 112,969,269 I89L possibly damaging Het
Grm8 A T 6: 28,125,853 D91E probably benign Het
Havcr1 C A 11: 46,752,507 H85N probably benign Het
Il12rb1 G A 8: 70,813,372 probably null Het
Kif3a A G 11: 53,598,327 K117E probably damaging Het
Kitl T A 10: 100,087,438 F15L probably benign Het
Ktn1 T G 14: 47,695,507 L706R probably damaging Het
Lipg T C 18: 74,948,047 Y321C probably damaging Het
Mapk8ip3 T C 17: 24,903,059 D710G probably benign Het
Mb21d1 A T 9: 78,435,556 S321R probably damaging Het
Mchr1 A G 15: 81,235,820 N16S probably benign Het
Myadml2 A T 11: 120,647,727 L94* probably null Het
Npr3 C A 15: 11,848,563 M439I probably benign Het
Obscn A G 11: 59,003,648 I6677T unknown Het
Ogn A C 13: 49,621,044 D221A probably benign Het
Olfr889 T C 9: 38,115,934 I46T probably benign Het
Pard3b C A 1: 62,637,894 Q1195K probably damaging Het
Pcsk4 T C 10: 80,321,951 E608G probably benign Het
Pdlim1 T C 19: 40,223,072 D259G probably benign Het
Per1 T C 11: 69,103,627 S526P probably damaging Het
Pfkfb2 A G 1: 130,706,472 V156A probably damaging Het
Ppp4r3a A T 12: 101,055,822 D307E probably damaging Het
Rims4 T C 2: 163,879,122 S70G probably damaging Het
Rnf213 T C 11: 119,441,839 F2625L probably benign Het
Sap130 T C 18: 31,666,472 L334P probably damaging Het
Slc16a10 T C 10: 40,076,800 I233V probably benign Het
Slc16a7 A C 10: 125,230,922 F283V possibly damaging Het
Slc25a24 T C 3: 109,136,270 M81T probably benign Het
Slc30a9 A G 5: 67,326,921 R134G probably damaging Het
Slc35d3 G T 10: 19,850,737 L96M probably damaging Het
Slc7a11 C T 3: 50,381,896 G333D probably damaging Het
Stam T C 2: 14,141,828 S446P probably benign Het
Stk38 T A 17: 28,979,232 N248I possibly damaging Het
Tle6 A C 10: 81,595,385 S221A probably benign Het
Tmprss11b G A 5: 86,661,631 T334I probably benign Het
Tmprss11c T A 5: 86,289,260 M1L possibly damaging Het
Tpm1 T C 9: 67,023,429 H262R probably benign Het
Tspan33 T C 6: 29,711,082 S118P possibly damaging Het
Tyk2 A G 9: 21,107,922 V1068A probably damaging Het
Ubr2 T C 17: 46,972,951 I591V probably benign Het
Vmn1r217 A T 13: 23,114,294 I146N possibly damaging Het
Zfp608 T C 18: 54,898,054 Y938C probably damaging Het
Other mutations in Utp20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00530:Utp20 APN 10 88825444 missense possibly damaging 0.90
IGL00858:Utp20 APN 10 88809125 missense possibly damaging 0.69
IGL00858:Utp20 APN 10 88809138 missense probably benign
IGL00946:Utp20 APN 10 88748315 missense possibly damaging 0.82
IGL01061:Utp20 APN 10 88770704 missense probably benign 0.13
IGL01399:Utp20 APN 10 88758302 critical splice donor site probably null
IGL01548:Utp20 APN 10 88764781 missense probably damaging 1.00
IGL01587:Utp20 APN 10 88787535 missense probably damaging 0.98
IGL01789:Utp20 APN 10 88798279 critical splice donor site probably null
IGL01819:Utp20 APN 10 88792687 missense probably damaging 1.00
IGL02070:Utp20 APN 10 88821877 splice site probably benign
IGL02231:Utp20 APN 10 88791168 missense probably damaging 1.00
IGL02244:Utp20 APN 10 88815956 splice site probably benign
IGL02367:Utp20 APN 10 88771853 unclassified probably benign
IGL02553:Utp20 APN 10 88764795 missense probably damaging 0.99
IGL02748:Utp20 APN 10 88817295 missense probably benign 0.00
IGL02831:Utp20 APN 10 88815908 missense probably benign
IGL02986:Utp20 APN 10 88775285 missense probably damaging 1.00
IGL02997:Utp20 APN 10 88814034 missense probably benign
IGL03105:Utp20 APN 10 88791096 missense probably benign 0.10
IGL03251:Utp20 APN 10 88817326 critical splice acceptor site probably null
IGL03337:Utp20 APN 10 88754566 missense probably benign
IGL03348:Utp20 APN 10 88758317 missense probably benign 0.09
IGL03381:Utp20 APN 10 88822005 missense probably damaging 0.99
Bell UTSW 10 88792625 missense probably benign 0.29
elite UTSW 10 88770808 missense probably benign
Margin UTSW 10 88768679 missense probably benign 0.04
Percentile UTSW 10 88775318 missense probably damaging 1.00
R0037:Utp20 UTSW 10 88798404 missense probably benign 0.05
R0107:Utp20 UTSW 10 88778391 missense probably benign 0.03
R0197:Utp20 UTSW 10 88777516 missense probably benign 0.22
R0219:Utp20 UTSW 10 88764675 missense probably damaging 1.00
R0315:Utp20 UTSW 10 88807421 missense probably damaging 1.00
R0328:Utp20 UTSW 10 88767107 missense possibly damaging 0.82
R0329:Utp20 UTSW 10 88817979 missense probably benign 0.00
R0330:Utp20 UTSW 10 88817979 missense probably benign 0.00
R0395:Utp20 UTSW 10 88818595 missense probably damaging 1.00
R0399:Utp20 UTSW 10 88820979 missense probably damaging 1.00
R0454:Utp20 UTSW 10 88822069 missense probably benign 0.00
R0456:Utp20 UTSW 10 88754573 missense possibly damaging 0.92
R0491:Utp20 UTSW 10 88760912 missense probably damaging 1.00
R0557:Utp20 UTSW 10 88748311 missense probably damaging 0.99
R0600:Utp20 UTSW 10 88767461 missense probably damaging 1.00
R0616:Utp20 UTSW 10 88770751 missense probably benign 0.14
R1076:Utp20 UTSW 10 88772459 missense probably benign 0.36
R1076:Utp20 UTSW 10 88772543 missense possibly damaging 0.86
R1330:Utp20 UTSW 10 88801189 missense probably damaging 0.96
R1440:Utp20 UTSW 10 88819339 missense probably benign 0.19
R1529:Utp20 UTSW 10 88753006 missense probably damaging 1.00
R1621:Utp20 UTSW 10 88762871 missense probably benign
R1641:Utp20 UTSW 10 88757972 missense possibly damaging 0.82
R1709:Utp20 UTSW 10 88749297 missense probably benign 0.29
R1734:Utp20 UTSW 10 88767461 missense probably damaging 1.00
R1755:Utp20 UTSW 10 88809769 missense probably benign 0.01
R1775:Utp20 UTSW 10 88770808 missense probably benign
R1866:Utp20 UTSW 10 88762770 nonsense probably null
R1867:Utp20 UTSW 10 88749443 missense probably benign
R1901:Utp20 UTSW 10 88753026 missense probably benign 0.02
R1902:Utp20 UTSW 10 88753026 missense probably benign 0.02
R1967:Utp20 UTSW 10 88816979 missense probably benign 0.03
R2060:Utp20 UTSW 10 88774795 missense probably damaging 0.98
R2102:Utp20 UTSW 10 88772917 missense probably damaging 0.99
R2110:Utp20 UTSW 10 88767451 critical splice donor site probably null
R2115:Utp20 UTSW 10 88786003 missense probably benign 0.02
R2128:Utp20 UTSW 10 88814055 missense probably damaging 0.99
R2129:Utp20 UTSW 10 88814055 missense probably damaging 0.99
R2180:Utp20 UTSW 10 88820939 missense probably damaging 0.98
R2280:Utp20 UTSW 10 88825503 splice site probably null
R2435:Utp20 UTSW 10 88820891 missense possibly damaging 0.89
R2914:Utp20 UTSW 10 88754475 critical splice donor site probably null
R3005:Utp20 UTSW 10 88777455 missense probably damaging 0.97
R3546:Utp20 UTSW 10 88782689 missense probably damaging 1.00
R3547:Utp20 UTSW 10 88782689 missense probably damaging 1.00
R3622:Utp20 UTSW 10 88757993 unclassified probably benign
R3737:Utp20 UTSW 10 88762806 missense probably benign 0.00
R3738:Utp20 UTSW 10 88762806 missense probably benign 0.00
R3841:Utp20 UTSW 10 88775203 unclassified probably benign
R4034:Utp20 UTSW 10 88762806 missense probably benign 0.00
R4035:Utp20 UTSW 10 88762806 missense probably benign 0.00
R4157:Utp20 UTSW 10 88761867 missense probably benign
R4243:Utp20 UTSW 10 88807325 critical splice donor site probably null
R4295:Utp20 UTSW 10 88754519 missense possibly damaging 0.54
R4632:Utp20 UTSW 10 88778261 missense probably damaging 1.00
R4633:Utp20 UTSW 10 88752952 missense probably benign
R4684:Utp20 UTSW 10 88807445 nonsense probably null
R4731:Utp20 UTSW 10 88754520 missense possibly damaging 0.93
R4735:Utp20 UTSW 10 88816918 missense possibly damaging 0.91
R4772:Utp20 UTSW 10 88809935 missense probably benign 0.09
R4912:Utp20 UTSW 10 88771960 missense probably benign 0.01
R4974:Utp20 UTSW 10 88816949 missense probably benign 0.08
R4991:Utp20 UTSW 10 88746934 missense probably benign 0.09
R5004:Utp20 UTSW 10 88748273 missense probably damaging 0.98
R5037:Utp20 UTSW 10 88775330 missense probably benign 0.00
R5043:Utp20 UTSW 10 88798746 missense possibly damaging 0.70
R5108:Utp20 UTSW 10 88768873 missense probably benign 0.00
R5138:Utp20 UTSW 10 88747377 missense probably damaging 0.96
R5252:Utp20 UTSW 10 88750670 missense probably benign 0.01
R5394:Utp20 UTSW 10 88772915 nonsense probably null
R5470:Utp20 UTSW 10 88817896 missense probably benign 0.14
R5558:Utp20 UTSW 10 88751467 missense probably damaging 1.00
R5678:Utp20 UTSW 10 88809117 missense probably benign 0.00
R5822:Utp20 UTSW 10 88817285 missense probably benign 0.00
R5866:Utp20 UTSW 10 88772559 missense possibly damaging 0.82
R5924:Utp20 UTSW 10 88815922 missense probably benign 0.00
R6026:Utp20 UTSW 10 88768679 missense probably benign 0.04
R6363:Utp20 UTSW 10 88757080 missense probably damaging 1.00
R6434:Utp20 UTSW 10 88772533 nonsense probably null
R6477:Utp20 UTSW 10 88768918 missense probably benign 0.05
R6480:Utp20 UTSW 10 88755186 critical splice donor site probably null
R6989:Utp20 UTSW 10 88778240 missense probably benign 0.00
R7033:Utp20 UTSW 10 88754475 critical splice donor site probably null
R7192:Utp20 UTSW 10 88772459 missense probably benign 0.09
R7236:Utp20 UTSW 10 88749342 missense probably benign 0.28
R7260:Utp20 UTSW 10 88751472 missense probably benign 0.39
R7296:Utp20 UTSW 10 88770724 missense probably benign 0.21
R7317:Utp20 UTSW 10 88762935 missense possibly damaging 0.83
R7318:Utp20 UTSW 10 88813949 missense possibly damaging 0.89
R7330:Utp20 UTSW 10 88787562 frame shift probably null
R7367:Utp20 UTSW 10 88795443 missense probably benign 0.21
R7432:Utp20 UTSW 10 88798398 missense probably benign 0.00
R7447:Utp20 UTSW 10 88772492 missense probably damaging 1.00
R7473:Utp20 UTSW 10 88820710 splice site probably null
R7520:Utp20 UTSW 10 88818595 missense probably damaging 1.00
R7530:Utp20 UTSW 10 88753006 missense probably damaging 1.00
R7539:Utp20 UTSW 10 88791745 missense probably damaging 1.00
R7651:Utp20 UTSW 10 88754595 missense probably benign 0.41
R7728:Utp20 UTSW 10 88798341 missense probably damaging 1.00
R7831:Utp20 UTSW 10 88762770 nonsense probably null
R7833:Utp20 UTSW 10 88801136 missense possibly damaging 0.92
R7909:Utp20 UTSW 10 88775330 missense probably benign
R7956:Utp20 UTSW 10 88782614 missense probably benign 0.23
R7999:Utp20 UTSW 10 88770388 missense probably benign
R8080:Utp20 UTSW 10 88782715 missense possibly damaging 0.82
R8098:Utp20 UTSW 10 88752948 missense probably benign 0.13
R8104:Utp20 UTSW 10 88757904 missense probably damaging 1.00
R8129:Utp20 UTSW 10 88792625 missense probably benign 0.29
R8147:Utp20 UTSW 10 88758444 missense probably benign 0.02
R8199:Utp20 UTSW 10 88798475 missense probably benign
R8222:Utp20 UTSW 10 88778372 missense probably damaging 1.00
R8415:Utp20 UTSW 10 88826604 critical splice donor site probably null
R8466:Utp20 UTSW 10 88818503 missense probably damaging 1.00
R8505:Utp20 UTSW 10 88818008 missense probably benign 0.03
R8774:Utp20 UTSW 10 88752901 splice site probably benign
R8802:Utp20 UTSW 10 88747295 missense probably damaging 1.00
R8923:Utp20 UTSW 10 88791742 nonsense probably null
R8945:Utp20 UTSW 10 88792670 nonsense probably null
R9065:Utp20 UTSW 10 88757110 missense probably benign 0.32
R9092:Utp20 UTSW 10 88768817 missense probably benign
R9092:Utp20 UTSW 10 88775318 missense probably damaging 1.00
R9094:Utp20 UTSW 10 88775318 missense probably damaging 1.00
R9095:Utp20 UTSW 10 88775318 missense probably damaging 1.00
R9096:Utp20 UTSW 10 88775318 missense probably damaging 1.00
R9229:Utp20 UTSW 10 88758377 missense possibly damaging 0.86
R9323:Utp20 UTSW 10 88747308 missense probably damaging 1.00
R9336:Utp20 UTSW 10 88813936 missense probably damaging 1.00
R9467:Utp20 UTSW 10 88804528 missense possibly damaging 0.68
R9545:Utp20 UTSW 10 88782649 missense probably benign 0.38
RF005:Utp20 UTSW 10 88825457 missense probably damaging 1.00
RF024:Utp20 UTSW 10 88825457 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGAAGGTATCACAGTCCCGCTC -3'
(R):5'- GTGTGGAATCTAGCAGAAGTCACCC -3'

Sequencing Primer
(F):5'- TCACGGTCAGTGCCCAC -3'
(R):5'- CCGTTTCAGTCCAGTCTAGC -3'
Posted On 2014-04-13