Incidental Mutation 'R1554:Slc16a7'
ID 170167
Institutional Source Beutler Lab
Gene Symbol Slc16a7
Ensembl Gene ENSMUSG00000020102
Gene Name solute carrier family 16 (monocarboxylic acid transporters), member 7
Synonyms 4921534N07Rik, 9030411M13Rik, D630004K10Rik, MCT2
MMRRC Submission 039593-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.060) question?
Stock # R1554 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 125055139-125225334 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 125066791 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Valine at position 283 (F283V)
Ref Sequence ENSEMBL: ENSMUSP00000147968 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063318] [ENSMUST00000105257] [ENSMUST00000210780] [ENSMUST00000211781]
AlphaFold O70451
Predicted Effect possibly damaging
Transcript: ENSMUST00000063318
AA Change: F283V

PolyPhen 2 Score 0.701 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000065433
Gene: ENSMUSG00000020102
AA Change: F283V

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:MFS_1 22 389 2e-37 PFAM
transmembrane domain 404 426 N/A INTRINSIC
coiled coil region 436 463 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000105257
AA Change: F283V

PolyPhen 2 Score 0.701 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000100892
Gene: ENSMUSG00000020102
AA Change: F283V

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:MFS_1 22 389 6e-37 PFAM
transmembrane domain 404 426 N/A INTRINSIC
coiled coil region 436 463 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000210780
AA Change: F283V

PolyPhen 2 Score 0.701 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect possibly damaging
Transcript: ENSMUST00000211781
AA Change: F283V

PolyPhen 2 Score 0.701 (Sensitivity: 0.86; Specificity: 0.92)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 89.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the monocarboxylate transporter family. Members in this family transport metabolites, such as lactate, pyruvate, and ketone bodies. The protein encoded by this gene catalyzes the proton-linked transport of monocarboxylates and has the highest affinity for pyruvate. This protein has been reported to be more highly expressed in prostate and colorectal cancer specimens when compared to control specimens. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf T A 19: 31,886,302 (GRCm39) D70E possibly damaging Het
Adamts7 A T 9: 90,055,703 (GRCm39) D152V probably damaging Het
Api5 T C 2: 94,255,988 (GRCm39) D233G probably benign Het
Btaf1 A G 19: 36,973,998 (GRCm39) D1390G probably benign Het
Cep135 G A 5: 76,782,060 (GRCm39) W893* probably null Het
Cgas A T 9: 78,342,838 (GRCm39) S321R probably damaging Het
Cmtm6 T A 9: 114,575,550 (GRCm39) V153D possibly damaging Het
Dnah11 C T 12: 118,046,234 (GRCm39) V1735I possibly damaging Het
Dnm1l T C 16: 16,159,290 (GRCm39) N104S probably benign Het
Dpyd A T 3: 118,858,695 (GRCm39) probably null Het
Dtx1 T C 5: 120,821,386 (GRCm39) K387R probably damaging Het
Ercc4 A G 16: 12,965,486 (GRCm39) D706G probably damaging Het
Fat2 T C 11: 55,144,490 (GRCm39) N4128S probably benign Het
Gm42669 T A 5: 107,655,653 (GRCm39) C639S possibly damaging Het
Grk3 T A 5: 113,117,135 (GRCm39) I89L possibly damaging Het
Grm8 A T 6: 28,125,852 (GRCm39) D91E probably benign Het
Havcr1 C A 11: 46,643,334 (GRCm39) H85N probably benign Het
Il12rb1 G A 8: 71,266,016 (GRCm39) probably null Het
Kif3a A G 11: 53,489,154 (GRCm39) K117E probably damaging Het
Kitl T A 10: 99,923,300 (GRCm39) F15L probably benign Het
Ktn1 T G 14: 47,932,964 (GRCm39) L706R probably damaging Het
Lipg T C 18: 75,081,118 (GRCm39) Y321C probably damaging Het
Mapk8ip3 T C 17: 25,122,033 (GRCm39) D710G probably benign Het
Mchr1 A G 15: 81,120,021 (GRCm39) N16S probably benign Het
Myadml2 A T 11: 120,538,553 (GRCm39) L94* probably null Het
Npr3 C A 15: 11,848,649 (GRCm39) M439I probably benign Het
Obscn A G 11: 58,894,474 (GRCm39) I6677T unknown Het
Ogn A C 13: 49,774,520 (GRCm39) D221A probably benign Het
Or8b40 T C 9: 38,027,230 (GRCm39) I46T probably benign Het
Pard3b C A 1: 62,677,053 (GRCm39) Q1195K probably damaging Het
Pcsk4 T C 10: 80,157,785 (GRCm39) E608G probably benign Het
Pdlim1 T C 19: 40,211,516 (GRCm39) D259G probably benign Het
Per1 T C 11: 68,994,453 (GRCm39) S526P probably damaging Het
Pfkfb2 A G 1: 130,634,209 (GRCm39) V156A probably damaging Het
Ppp4r3a A T 12: 101,022,081 (GRCm39) D307E probably damaging Het
Rims4 T C 2: 163,721,042 (GRCm39) S70G probably damaging Het
Rnf213 T C 11: 119,332,665 (GRCm39) F2625L probably benign Het
Sap130 T C 18: 31,799,525 (GRCm39) L334P probably damaging Het
Slc16a10 T C 10: 39,952,796 (GRCm39) I233V probably benign Het
Slc25a24 T C 3: 109,043,586 (GRCm39) M81T probably benign Het
Slc30a9 A G 5: 67,484,264 (GRCm39) R134G probably damaging Het
Slc35d3 G T 10: 19,726,483 (GRCm39) L96M probably damaging Het
Slc7a11 C T 3: 50,336,345 (GRCm39) G333D probably damaging Het
Stam T C 2: 14,146,639 (GRCm39) S446P probably benign Het
Stk38 T A 17: 29,198,206 (GRCm39) N248I possibly damaging Het
Tasor2 A G 13: 3,626,374 (GRCm39) V1192A possibly damaging Het
Tle6 A C 10: 81,431,219 (GRCm39) S221A probably benign Het
Tmprss11b G A 5: 86,809,490 (GRCm39) T334I probably benign Het
Tmprss11c T A 5: 86,437,119 (GRCm39) M1L possibly damaging Het
Tpm1 T C 9: 66,930,711 (GRCm39) H262R probably benign Het
Tspan33 T C 6: 29,711,081 (GRCm39) S118P possibly damaging Het
Tyk2 A G 9: 21,019,218 (GRCm39) V1068A probably damaging Het
Ubr2 T C 17: 47,283,877 (GRCm39) I591V probably benign Het
Utp20 A T 10: 88,600,599 (GRCm39) Y38* probably null Het
Vmn1r217 A T 13: 23,298,464 (GRCm39) I146N possibly damaging Het
Zfp608 T C 18: 55,031,126 (GRCm39) Y938C probably damaging Het
Other mutations in Slc16a7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00857:Slc16a7 APN 10 125,066,803 (GRCm39) missense probably benign 0.16
IGL02228:Slc16a7 APN 10 125,066,667 (GRCm39) missense probably damaging 1.00
IGL02500:Slc16a7 APN 10 125,066,802 (GRCm39) missense probably damaging 1.00
IGL03277:Slc16a7 APN 10 125,066,560 (GRCm39) missense probably benign 0.00
R0044:Slc16a7 UTSW 10 125,063,951 (GRCm39) missense probably benign 0.01
R0076:Slc16a7 UTSW 10 125,063,939 (GRCm39) missense probably benign 0.34
R0285:Slc16a7 UTSW 10 125,130,500 (GRCm39) missense probably benign 0.22
R0546:Slc16a7 UTSW 10 125,066,742 (GRCm39) missense probably benign 0.02
R0898:Slc16a7 UTSW 10 125,069,370 (GRCm39) missense possibly damaging 0.46
R1123:Slc16a7 UTSW 10 125,067,016 (GRCm39) missense probably benign 0.00
R1173:Slc16a7 UTSW 10 125,067,241 (GRCm39) missense possibly damaging 0.82
R1459:Slc16a7 UTSW 10 125,066,489 (GRCm39) nonsense probably null
R1838:Slc16a7 UTSW 10 125,067,067 (GRCm39) missense probably damaging 1.00
R3545:Slc16a7 UTSW 10 125,130,569 (GRCm39) nonsense probably null
R3546:Slc16a7 UTSW 10 125,130,569 (GRCm39) nonsense probably null
R3547:Slc16a7 UTSW 10 125,130,569 (GRCm39) nonsense probably null
R3934:Slc16a7 UTSW 10 125,066,712 (GRCm39) missense probably damaging 1.00
R3935:Slc16a7 UTSW 10 125,066,712 (GRCm39) missense probably damaging 1.00
R4499:Slc16a7 UTSW 10 125,064,056 (GRCm39) missense probably damaging 1.00
R4512:Slc16a7 UTSW 10 125,069,308 (GRCm39) splice site probably null
R4513:Slc16a7 UTSW 10 125,069,308 (GRCm39) splice site probably null
R4514:Slc16a7 UTSW 10 125,069,308 (GRCm39) splice site probably null
R5157:Slc16a7 UTSW 10 125,069,333 (GRCm39) nonsense probably null
R5247:Slc16a7 UTSW 10 125,067,183 (GRCm39) missense probably damaging 1.00
R5385:Slc16a7 UTSW 10 125,130,473 (GRCm39) missense possibly damaging 0.85
R6198:Slc16a7 UTSW 10 125,064,084 (GRCm39) missense probably benign
R6263:Slc16a7 UTSW 10 125,130,508 (GRCm39) missense probably benign 0.16
R6430:Slc16a7 UTSW 10 125,066,887 (GRCm39) missense probably damaging 0.97
R7450:Slc16a7 UTSW 10 125,063,920 (GRCm39) missense probably benign 0.00
R7680:Slc16a7 UTSW 10 125,066,805 (GRCm39) missense probably benign 0.19
R8125:Slc16a7 UTSW 10 125,164,202 (GRCm39) critical splice donor site probably null
R9133:Slc16a7 UTSW 10 125,066,536 (GRCm39) missense probably benign 0.00
R9301:Slc16a7 UTSW 10 125,066,880 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GAACCTGGTAGCTCCAACAATGTCC -3'
(R):5'- GAAGACGACCACTTGCAAATGGC -3'

Sequencing Primer
(F):5'- TGGTAGCTCCAACAATGTCCATAAG -3'
(R):5'- TGTTGGGCCAAGTCCAAATAC -3'
Posted On 2014-04-13