Incidental Mutation 'R1554:Ppp4r3a'
ID 170180
Institutional Source Beutler Lab
Gene Symbol Ppp4r3a
Ensembl Gene ENSMUSG00000041846
Gene Name protein phosphatase 4 regulatory subunit 3A
Synonyms 1110034C04Rik, Smek1
MMRRC Submission 039593-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.232) question?
Stock # R1554 (G1)
Quality Score 225
Status Not validated
Chromosome 12
Chromosomal Location 101039409-101083702 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 101055822 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 307 (D307E)
Ref Sequence ENSEMBL: ENSMUSP00000129654 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048305] [ENSMUST00000163095] [ENSMUST00000223091]
AlphaFold Q6P2K6
Predicted Effect probably damaging
Transcript: ENSMUST00000048305
AA Change: D307E

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000041667
Gene: ENSMUSG00000041846
AA Change: D307E

SCOP:d1k5db_ 7 96 3e-24 SMART
Pfam:SMK-1 164 357 5.8e-85 PFAM
low complexity region 407 418 N/A INTRINSIC
low complexity region 495 503 N/A INTRINSIC
low complexity region 705 720 N/A INTRINSIC
low complexity region 753 770 N/A INTRINSIC
low complexity region 795 808 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000163095
AA Change: D307E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000129654
Gene: ENSMUSG00000041846
AA Change: D307E

SCOP:d1k5db_ 7 96 4e-24 SMART
Pfam:SMK-1 166 357 2.5e-84 PFAM
low complexity region 508 516 N/A INTRINSIC
low complexity region 718 733 N/A INTRINSIC
low complexity region 766 783 N/A INTRINSIC
low complexity region 808 821 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000223091
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223161
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 89.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf T A 19: 31,908,902 D70E possibly damaging Het
Adamts7 A T 9: 90,173,650 D152V probably damaging Het
Api5 T C 2: 94,425,643 D233G probably benign Het
Btaf1 A G 19: 36,996,598 D1390G probably benign Het
Cep135 G A 5: 76,634,213 W893* probably null Het
Cmtm6 T A 9: 114,746,482 V153D possibly damaging Het
Dnah11 C T 12: 118,082,499 V1735I possibly damaging Het
Dnm1l T C 16: 16,341,426 N104S probably benign Het
Dpyd A T 3: 119,065,046 probably null Het
Dtx1 T C 5: 120,683,321 K387R probably damaging Het
Ercc4 A G 16: 13,147,622 D706G probably damaging Het
Fam208b A G 13: 3,576,374 V1192A possibly damaging Het
Fat2 T C 11: 55,253,664 N4128S probably benign Het
Gm42669 T A 5: 107,507,787 C639S possibly damaging Het
Grk3 T A 5: 112,969,269 I89L possibly damaging Het
Grm8 A T 6: 28,125,853 D91E probably benign Het
Havcr1 C A 11: 46,752,507 H85N probably benign Het
Il12rb1 G A 8: 70,813,372 probably null Het
Kif3a A G 11: 53,598,327 K117E probably damaging Het
Kitl T A 10: 100,087,438 F15L probably benign Het
Ktn1 T G 14: 47,695,507 L706R probably damaging Het
Lipg T C 18: 74,948,047 Y321C probably damaging Het
Mapk8ip3 T C 17: 24,903,059 D710G probably benign Het
Mb21d1 A T 9: 78,435,556 S321R probably damaging Het
Mchr1 A G 15: 81,235,820 N16S probably benign Het
Myadml2 A T 11: 120,647,727 L94* probably null Het
Npr3 C A 15: 11,848,563 M439I probably benign Het
Obscn A G 11: 59,003,648 I6677T unknown Het
Ogn A C 13: 49,621,044 D221A probably benign Het
Olfr889 T C 9: 38,115,934 I46T probably benign Het
Pard3b C A 1: 62,637,894 Q1195K probably damaging Het
Pcsk4 T C 10: 80,321,951 E608G probably benign Het
Pdlim1 T C 19: 40,223,072 D259G probably benign Het
Per1 T C 11: 69,103,627 S526P probably damaging Het
Pfkfb2 A G 1: 130,706,472 V156A probably damaging Het
Rims4 T C 2: 163,879,122 S70G probably damaging Het
Rnf213 T C 11: 119,441,839 F2625L probably benign Het
Sap130 T C 18: 31,666,472 L334P probably damaging Het
Slc16a10 T C 10: 40,076,800 I233V probably benign Het
Slc16a7 A C 10: 125,230,922 F283V possibly damaging Het
Slc25a24 T C 3: 109,136,270 M81T probably benign Het
Slc30a9 A G 5: 67,326,921 R134G probably damaging Het
Slc35d3 G T 10: 19,850,737 L96M probably damaging Het
Slc7a11 C T 3: 50,381,896 G333D probably damaging Het
Stam T C 2: 14,141,828 S446P probably benign Het
Stk38 T A 17: 28,979,232 N248I possibly damaging Het
Tle6 A C 10: 81,595,385 S221A probably benign Het
Tmprss11b G A 5: 86,661,631 T334I probably benign Het
Tmprss11c T A 5: 86,289,260 M1L possibly damaging Het
Tpm1 T C 9: 67,023,429 H262R probably benign Het
Tspan33 T C 6: 29,711,082 S118P possibly damaging Het
Tyk2 A G 9: 21,107,922 V1068A probably damaging Het
Ubr2 T C 17: 46,972,951 I591V probably benign Het
Utp20 A T 10: 88,764,737 Y38* probably null Het
Vmn1r217 A T 13: 23,114,294 I146N possibly damaging Het
Zfp608 T C 18: 54,898,054 Y938C probably damaging Het
Other mutations in Ppp4r3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Ppp4r3a APN 12 101049794 missense probably damaging 1.00
IGL00532:Ppp4r3a APN 12 101044653 missense probably damaging 1.00
IGL01359:Ppp4r3a APN 12 101058496 missense probably damaging 0.99
IGL01873:Ppp4r3a APN 12 101041835 missense possibly damaging 0.86
IGL02676:Ppp4r3a APN 12 101042511 missense probably benign 0.00
IGL02756:Ppp4r3a APN 12 101058323 critical splice donor site probably null
IGL03196:Ppp4r3a APN 12 101049654 splice site probably benign
IGL03206:Ppp4r3a APN 12 101058619 missense probably damaging 1.00
R1101:Ppp4r3a UTSW 12 101051571 missense probably damaging 0.98
R1434:Ppp4r3a UTSW 12 101043524 missense probably damaging 0.99
R1526:Ppp4r3a UTSW 12 101040741 missense probably damaging 0.99
R1650:Ppp4r3a UTSW 12 101044619 missense probably damaging 0.99
R1766:Ppp4r3a UTSW 12 101058482 missense probably damaging 0.99
R2152:Ppp4r3a UTSW 12 101042567 missense probably damaging 0.99
R2322:Ppp4r3a UTSW 12 101042619 missense probably damaging 0.98
R2421:Ppp4r3a UTSW 12 101042653 splice site probably benign
R2422:Ppp4r3a UTSW 12 101042653 splice site probably benign
R2859:Ppp4r3a UTSW 12 101042647 critical splice acceptor site probably null
R2884:Ppp4r3a UTSW 12 101068677 missense probably damaging 0.99
R4157:Ppp4r3a UTSW 12 101055619 missense probably damaging 0.97
R4651:Ppp4r3a UTSW 12 101082911 utr 5 prime probably benign
R4652:Ppp4r3a UTSW 12 101082911 utr 5 prime probably benign
R4706:Ppp4r3a UTSW 12 101041916 missense probably damaging 1.00
R4773:Ppp4r3a UTSW 12 101082767 missense possibly damaging 0.93
R4775:Ppp4r3a UTSW 12 101053566 missense probably damaging 0.99
R5467:Ppp4r3a UTSW 12 101043470 missense probably damaging 0.99
R5634:Ppp4r3a UTSW 12 101043521 missense probably damaging 1.00
R5704:Ppp4r3a UTSW 12 101083360 utr 5 prime probably benign
R5707:Ppp4r3a UTSW 12 101058511 missense probably damaging 1.00
R5935:Ppp4r3a UTSW 12 101051613 missense probably damaging 1.00
R5969:Ppp4r3a UTSW 12 101043579 missense probably benign
R6030:Ppp4r3a UTSW 12 101058400 missense probably damaging 0.97
R6030:Ppp4r3a UTSW 12 101058400 missense probably damaging 0.97
R6630:Ppp4r3a UTSW 12 101049776 missense probably damaging 1.00
R7265:Ppp4r3a UTSW 12 101053511 missense possibly damaging 0.77
R7352:Ppp4r3a UTSW 12 101041832 missense probably damaging 1.00
R7402:Ppp4r3a UTSW 12 101058794 missense possibly damaging 0.94
R7761:Ppp4r3a UTSW 12 101055821 missense probably damaging 0.98
R7808:Ppp4r3a UTSW 12 101053496 missense possibly damaging 0.94
R7811:Ppp4r3a UTSW 12 101053562 missense probably damaging 0.98
R8062:Ppp4r3a UTSW 12 101041971 missense probably damaging 0.98
R8409:Ppp4r3a UTSW 12 101042493 missense probably benign 0.02
R8435:Ppp4r3a UTSW 12 101082789 missense probably benign 0.19
R8471:Ppp4r3a UTSW 12 101055642 missense probably benign 0.01
R9010:Ppp4r3a UTSW 12 101058332 missense possibly damaging 0.58
R9137:Ppp4r3a UTSW 12 101055535 missense possibly damaging 0.95
R9335:Ppp4r3a UTSW 12 101040754 missense probably damaging 1.00
R9336:Ppp4r3a UTSW 12 101049660 missense probably benign
R9666:Ppp4r3a UTSW 12 101082870 start codon destroyed probably null 0.39
R9752:Ppp4r3a UTSW 12 101042504 missense probably benign 0.01
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- tcattgtaacacagctatactcattc -3'
Posted On 2014-04-13