Incidental Mutation 'R1554:Ppp4r3a'
ID 170180
Institutional Source Beutler Lab
Gene Symbol Ppp4r3a
Ensembl Gene ENSMUSG00000041846
Gene Name protein phosphatase 4 regulatory subunit 3A
Synonyms 1110034C04Rik, Smek1
MMRRC Submission 039593-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.351) question?
Stock # R1554 (G1)
Quality Score 225
Status Not validated
Chromosome 12
Chromosomal Location 101005668-101049961 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 101022081 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 307 (D307E)
Ref Sequence ENSEMBL: ENSMUSP00000129654 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048305] [ENSMUST00000163095] [ENSMUST00000223091]
AlphaFold Q6P2K6
Predicted Effect probably damaging
Transcript: ENSMUST00000048305
AA Change: D307E

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000041667
Gene: ENSMUSG00000041846
AA Change: D307E

DomainStartEndE-ValueType
SCOP:d1k5db_ 7 96 3e-24 SMART
Pfam:SMK-1 164 357 5.8e-85 PFAM
low complexity region 407 418 N/A INTRINSIC
low complexity region 495 503 N/A INTRINSIC
low complexity region 705 720 N/A INTRINSIC
low complexity region 753 770 N/A INTRINSIC
low complexity region 795 808 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000163095
AA Change: D307E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000129654
Gene: ENSMUSG00000041846
AA Change: D307E

DomainStartEndE-ValueType
SCOP:d1k5db_ 7 96 4e-24 SMART
Pfam:SMK-1 166 357 2.5e-84 PFAM
low complexity region 508 516 N/A INTRINSIC
low complexity region 718 733 N/A INTRINSIC
low complexity region 766 783 N/A INTRINSIC
low complexity region 808 821 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000223091
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223161
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 89.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf T A 19: 31,886,302 (GRCm39) D70E possibly damaging Het
Adamts7 A T 9: 90,055,703 (GRCm39) D152V probably damaging Het
Api5 T C 2: 94,255,988 (GRCm39) D233G probably benign Het
Btaf1 A G 19: 36,973,998 (GRCm39) D1390G probably benign Het
Cep135 G A 5: 76,782,060 (GRCm39) W893* probably null Het
Cgas A T 9: 78,342,838 (GRCm39) S321R probably damaging Het
Cmtm6 T A 9: 114,575,550 (GRCm39) V153D possibly damaging Het
Dnah11 C T 12: 118,046,234 (GRCm39) V1735I possibly damaging Het
Dnm1l T C 16: 16,159,290 (GRCm39) N104S probably benign Het
Dpyd A T 3: 118,858,695 (GRCm39) probably null Het
Dtx1 T C 5: 120,821,386 (GRCm39) K387R probably damaging Het
Ercc4 A G 16: 12,965,486 (GRCm39) D706G probably damaging Het
Fat2 T C 11: 55,144,490 (GRCm39) N4128S probably benign Het
Gm42669 T A 5: 107,655,653 (GRCm39) C639S possibly damaging Het
Grk3 T A 5: 113,117,135 (GRCm39) I89L possibly damaging Het
Grm8 A T 6: 28,125,852 (GRCm39) D91E probably benign Het
Havcr1 C A 11: 46,643,334 (GRCm39) H85N probably benign Het
Il12rb1 G A 8: 71,266,016 (GRCm39) probably null Het
Kif3a A G 11: 53,489,154 (GRCm39) K117E probably damaging Het
Kitl T A 10: 99,923,300 (GRCm39) F15L probably benign Het
Ktn1 T G 14: 47,932,964 (GRCm39) L706R probably damaging Het
Lipg T C 18: 75,081,118 (GRCm39) Y321C probably damaging Het
Mapk8ip3 T C 17: 25,122,033 (GRCm39) D710G probably benign Het
Mchr1 A G 15: 81,120,021 (GRCm39) N16S probably benign Het
Myadml2 A T 11: 120,538,553 (GRCm39) L94* probably null Het
Npr3 C A 15: 11,848,649 (GRCm39) M439I probably benign Het
Obscn A G 11: 58,894,474 (GRCm39) I6677T unknown Het
Ogn A C 13: 49,774,520 (GRCm39) D221A probably benign Het
Or8b40 T C 9: 38,027,230 (GRCm39) I46T probably benign Het
Pard3b C A 1: 62,677,053 (GRCm39) Q1195K probably damaging Het
Pcsk4 T C 10: 80,157,785 (GRCm39) E608G probably benign Het
Pdlim1 T C 19: 40,211,516 (GRCm39) D259G probably benign Het
Per1 T C 11: 68,994,453 (GRCm39) S526P probably damaging Het
Pfkfb2 A G 1: 130,634,209 (GRCm39) V156A probably damaging Het
Rims4 T C 2: 163,721,042 (GRCm39) S70G probably damaging Het
Rnf213 T C 11: 119,332,665 (GRCm39) F2625L probably benign Het
Sap130 T C 18: 31,799,525 (GRCm39) L334P probably damaging Het
Slc16a10 T C 10: 39,952,796 (GRCm39) I233V probably benign Het
Slc16a7 A C 10: 125,066,791 (GRCm39) F283V possibly damaging Het
Slc25a24 T C 3: 109,043,586 (GRCm39) M81T probably benign Het
Slc30a9 A G 5: 67,484,264 (GRCm39) R134G probably damaging Het
Slc35d3 G T 10: 19,726,483 (GRCm39) L96M probably damaging Het
Slc7a11 C T 3: 50,336,345 (GRCm39) G333D probably damaging Het
Stam T C 2: 14,146,639 (GRCm39) S446P probably benign Het
Stk38 T A 17: 29,198,206 (GRCm39) N248I possibly damaging Het
Tasor2 A G 13: 3,626,374 (GRCm39) V1192A possibly damaging Het
Tle6 A C 10: 81,431,219 (GRCm39) S221A probably benign Het
Tmprss11b G A 5: 86,809,490 (GRCm39) T334I probably benign Het
Tmprss11c T A 5: 86,437,119 (GRCm39) M1L possibly damaging Het
Tpm1 T C 9: 66,930,711 (GRCm39) H262R probably benign Het
Tspan33 T C 6: 29,711,081 (GRCm39) S118P possibly damaging Het
Tyk2 A G 9: 21,019,218 (GRCm39) V1068A probably damaging Het
Ubr2 T C 17: 47,283,877 (GRCm39) I591V probably benign Het
Utp20 A T 10: 88,600,599 (GRCm39) Y38* probably null Het
Vmn1r217 A T 13: 23,298,464 (GRCm39) I146N possibly damaging Het
Zfp608 T C 18: 55,031,126 (GRCm39) Y938C probably damaging Het
Other mutations in Ppp4r3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Ppp4r3a APN 12 101,016,053 (GRCm39) missense probably damaging 1.00
IGL00532:Ppp4r3a APN 12 101,010,912 (GRCm39) missense probably damaging 1.00
IGL01359:Ppp4r3a APN 12 101,024,755 (GRCm39) missense probably damaging 0.99
IGL01873:Ppp4r3a APN 12 101,008,094 (GRCm39) missense possibly damaging 0.86
IGL02676:Ppp4r3a APN 12 101,008,770 (GRCm39) missense probably benign 0.00
IGL02756:Ppp4r3a APN 12 101,024,582 (GRCm39) critical splice donor site probably null
IGL03196:Ppp4r3a APN 12 101,015,913 (GRCm39) splice site probably benign
IGL03206:Ppp4r3a APN 12 101,024,878 (GRCm39) missense probably damaging 1.00
R1101:Ppp4r3a UTSW 12 101,017,830 (GRCm39) missense probably damaging 0.98
R1434:Ppp4r3a UTSW 12 101,009,783 (GRCm39) missense probably damaging 0.99
R1526:Ppp4r3a UTSW 12 101,007,000 (GRCm39) missense probably damaging 0.99
R1650:Ppp4r3a UTSW 12 101,010,878 (GRCm39) missense probably damaging 0.99
R1766:Ppp4r3a UTSW 12 101,024,741 (GRCm39) missense probably damaging 0.99
R2152:Ppp4r3a UTSW 12 101,008,826 (GRCm39) missense probably damaging 0.99
R2322:Ppp4r3a UTSW 12 101,008,878 (GRCm39) missense probably damaging 0.98
R2421:Ppp4r3a UTSW 12 101,008,912 (GRCm39) splice site probably benign
R2422:Ppp4r3a UTSW 12 101,008,912 (GRCm39) splice site probably benign
R2859:Ppp4r3a UTSW 12 101,008,906 (GRCm39) critical splice acceptor site probably null
R2884:Ppp4r3a UTSW 12 101,034,936 (GRCm39) missense probably damaging 0.99
R4157:Ppp4r3a UTSW 12 101,021,878 (GRCm39) missense probably damaging 0.97
R4651:Ppp4r3a UTSW 12 101,049,170 (GRCm39) utr 5 prime probably benign
R4652:Ppp4r3a UTSW 12 101,049,170 (GRCm39) utr 5 prime probably benign
R4706:Ppp4r3a UTSW 12 101,008,175 (GRCm39) missense probably damaging 1.00
R4773:Ppp4r3a UTSW 12 101,049,026 (GRCm39) missense possibly damaging 0.93
R4775:Ppp4r3a UTSW 12 101,019,825 (GRCm39) missense probably damaging 0.99
R5467:Ppp4r3a UTSW 12 101,009,729 (GRCm39) missense probably damaging 0.99
R5634:Ppp4r3a UTSW 12 101,009,780 (GRCm39) missense probably damaging 1.00
R5704:Ppp4r3a UTSW 12 101,049,619 (GRCm39) utr 5 prime probably benign
R5707:Ppp4r3a UTSW 12 101,024,770 (GRCm39) missense probably damaging 1.00
R5935:Ppp4r3a UTSW 12 101,017,872 (GRCm39) missense probably damaging 1.00
R5969:Ppp4r3a UTSW 12 101,009,838 (GRCm39) missense probably benign
R6030:Ppp4r3a UTSW 12 101,024,659 (GRCm39) missense probably damaging 0.97
R6030:Ppp4r3a UTSW 12 101,024,659 (GRCm39) missense probably damaging 0.97
R6630:Ppp4r3a UTSW 12 101,016,035 (GRCm39) missense probably damaging 1.00
R7265:Ppp4r3a UTSW 12 101,019,770 (GRCm39) missense possibly damaging 0.77
R7352:Ppp4r3a UTSW 12 101,008,091 (GRCm39) missense probably damaging 1.00
R7402:Ppp4r3a UTSW 12 101,025,053 (GRCm39) missense possibly damaging 0.94
R7761:Ppp4r3a UTSW 12 101,022,080 (GRCm39) missense probably damaging 0.98
R7808:Ppp4r3a UTSW 12 101,019,755 (GRCm39) missense possibly damaging 0.94
R7811:Ppp4r3a UTSW 12 101,019,821 (GRCm39) missense probably damaging 0.98
R8062:Ppp4r3a UTSW 12 101,008,230 (GRCm39) missense probably damaging 0.98
R8222:Ppp4r3a UTSW 12 101,008,164 (GRCm39) missense probably benign 0.09
R8409:Ppp4r3a UTSW 12 101,008,752 (GRCm39) missense probably benign 0.02
R8435:Ppp4r3a UTSW 12 101,049,048 (GRCm39) missense probably benign 0.19
R8471:Ppp4r3a UTSW 12 101,021,901 (GRCm39) missense probably benign 0.01
R9010:Ppp4r3a UTSW 12 101,024,591 (GRCm39) missense possibly damaging 0.58
R9137:Ppp4r3a UTSW 12 101,021,794 (GRCm39) missense possibly damaging 0.95
R9335:Ppp4r3a UTSW 12 101,007,013 (GRCm39) missense probably damaging 1.00
R9336:Ppp4r3a UTSW 12 101,015,919 (GRCm39) missense probably benign
R9666:Ppp4r3a UTSW 12 101,049,129 (GRCm39) start codon destroyed probably null 0.39
R9752:Ppp4r3a UTSW 12 101,008,763 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCTCACAAGGTGGTTCAGAATGAAGATA -3'
(R):5'- GCTAGGTGCTGGGTGATTTCACA -3'

Sequencing Primer
(F):5'- GACTTCTAAAGCTGGTAATATGCCC -3'
(R):5'- tcattgtaacacagctatactcattc -3'
Posted On 2014-04-13