Incidental Mutation 'R1554:Fam208b'
ID 170182
Institutional Source Beutler Lab
Gene Symbol Fam208b
Ensembl Gene ENSMUSG00000033799
Gene Name family with sequence similarity 208, member B
Synonyms BC016423
MMRRC Submission 039593-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock # R1554 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 3566035-3611108 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 3576374 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 1192 (V1192A)
Ref Sequence ENSEMBL: ENSMUSP00000093774 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096069]
AlphaFold Q5DTT3
Predicted Effect possibly damaging
Transcript: ENSMUST00000096069
AA Change: V1192A

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000093774
Gene: ENSMUSG00000033799
AA Change: V1192A

DomainStartEndE-ValueType
Pfam:DUF3699 91 167 1.4e-24 PFAM
low complexity region 272 282 N/A INTRINSIC
low complexity region 447 459 N/A INTRINSIC
Pfam:DUF3715 533 695 2.3e-25 PFAM
low complexity region 1156 1168 N/A INTRINSIC
low complexity region 1196 1207 N/A INTRINSIC
low complexity region 1312 1330 N/A INTRINSIC
low complexity region 2012 2021 N/A INTRINSIC
low complexity region 2250 2263 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221059
Predicted Effect unknown
Transcript: ENSMUST00000222909
AA Change: V510A
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 89.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf T A 19: 31,908,902 D70E possibly damaging Het
Adamts7 A T 9: 90,173,650 D152V probably damaging Het
Api5 T C 2: 94,425,643 D233G probably benign Het
Btaf1 A G 19: 36,996,598 D1390G probably benign Het
Cep135 G A 5: 76,634,213 W893* probably null Het
Cmtm6 T A 9: 114,746,482 V153D possibly damaging Het
Dnah11 C T 12: 118,082,499 V1735I possibly damaging Het
Dnm1l T C 16: 16,341,426 N104S probably benign Het
Dpyd A T 3: 119,065,046 probably null Het
Dtx1 T C 5: 120,683,321 K387R probably damaging Het
Ercc4 A G 16: 13,147,622 D706G probably damaging Het
Fat2 T C 11: 55,253,664 N4128S probably benign Het
Gm42669 T A 5: 107,507,787 C639S possibly damaging Het
Grk3 T A 5: 112,969,269 I89L possibly damaging Het
Grm8 A T 6: 28,125,853 D91E probably benign Het
Havcr1 C A 11: 46,752,507 H85N probably benign Het
Il12rb1 G A 8: 70,813,372 probably null Het
Kif3a A G 11: 53,598,327 K117E probably damaging Het
Kitl T A 10: 100,087,438 F15L probably benign Het
Ktn1 T G 14: 47,695,507 L706R probably damaging Het
Lipg T C 18: 74,948,047 Y321C probably damaging Het
Mapk8ip3 T C 17: 24,903,059 D710G probably benign Het
Mb21d1 A T 9: 78,435,556 S321R probably damaging Het
Mchr1 A G 15: 81,235,820 N16S probably benign Het
Myadml2 A T 11: 120,647,727 L94* probably null Het
Npr3 C A 15: 11,848,563 M439I probably benign Het
Obscn A G 11: 59,003,648 I6677T unknown Het
Ogn A C 13: 49,621,044 D221A probably benign Het
Olfr889 T C 9: 38,115,934 I46T probably benign Het
Pard3b C A 1: 62,637,894 Q1195K probably damaging Het
Pcsk4 T C 10: 80,321,951 E608G probably benign Het
Pdlim1 T C 19: 40,223,072 D259G probably benign Het
Per1 T C 11: 69,103,627 S526P probably damaging Het
Pfkfb2 A G 1: 130,706,472 V156A probably damaging Het
Ppp4r3a A T 12: 101,055,822 D307E probably damaging Het
Rims4 T C 2: 163,879,122 S70G probably damaging Het
Rnf213 T C 11: 119,441,839 F2625L probably benign Het
Sap130 T C 18: 31,666,472 L334P probably damaging Het
Slc16a10 T C 10: 40,076,800 I233V probably benign Het
Slc16a7 A C 10: 125,230,922 F283V possibly damaging Het
Slc25a24 T C 3: 109,136,270 M81T probably benign Het
Slc30a9 A G 5: 67,326,921 R134G probably damaging Het
Slc35d3 G T 10: 19,850,737 L96M probably damaging Het
Slc7a11 C T 3: 50,381,896 G333D probably damaging Het
Stam T C 2: 14,141,828 S446P probably benign Het
Stk38 T A 17: 28,979,232 N248I possibly damaging Het
Tle6 A C 10: 81,595,385 S221A probably benign Het
Tmprss11b G A 5: 86,661,631 T334I probably benign Het
Tmprss11c T A 5: 86,289,260 M1L possibly damaging Het
Tpm1 T C 9: 67,023,429 H262R probably benign Het
Tspan33 T C 6: 29,711,082 S118P possibly damaging Het
Tyk2 A G 9: 21,107,922 V1068A probably damaging Het
Ubr2 T C 17: 46,972,951 I591V probably benign Het
Utp20 A T 10: 88,764,737 Y38* probably null Het
Vmn1r217 A T 13: 23,114,294 I146N possibly damaging Het
Zfp608 T C 18: 54,898,054 Y938C probably damaging Het
Other mutations in Fam208b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00330:Fam208b APN 13 3574832 missense probably benign
IGL00670:Fam208b APN 13 3585241 missense probably benign 0.14
IGL00957:Fam208b APN 13 3577101 missense possibly damaging 0.86
IGL01311:Fam208b APN 13 3575885 missense possibly damaging 0.85
IGL01318:Fam208b APN 13 3575067 missense possibly damaging 0.66
IGL01767:Fam208b APN 13 3576633 missense probably benign 0.00
IGL02073:Fam208b APN 13 3574721 missense probably benign 0.01
IGL02152:Fam208b APN 13 3585371 missense probably benign
IGL02431:Fam208b APN 13 3574736 missense possibly damaging 0.85
IGL02478:Fam208b APN 13 3574661 missense probably benign 0.12
IGL02732:Fam208b APN 13 3573626 missense probably benign 0.09
IGL02745:Fam208b APN 13 3585140 missense probably benign 0.23
IGL02800:Fam208b APN 13 3585154 missense probably benign
IGL02989:Fam208b APN 13 3584820 missense probably benign 0.01
IGL03124:Fam208b APN 13 3574704 missense probably benign 0.41
IGL03154:Fam208b APN 13 3575255 missense possibly damaging 0.56
IGL03216:Fam208b APN 13 3574553 missense probably damaging 0.98
BB001:Fam208b UTSW 13 3594331 missense possibly damaging 0.92
BB011:Fam208b UTSW 13 3594331 missense possibly damaging 0.92
H8562:Fam208b UTSW 13 3577000 missense probably damaging 0.98
PIT4585001:Fam208b UTSW 13 3574979 missense possibly damaging 0.55
R0016:Fam208b UTSW 13 3585170 splice site probably null
R0016:Fam208b UTSW 13 3585170 splice site probably null
R0157:Fam208b UTSW 13 3575550 missense probably benign 0.06
R0375:Fam208b UTSW 13 3596842 missense possibly damaging 0.85
R0403:Fam208b UTSW 13 3582052 nonsense probably null
R0472:Fam208b UTSW 13 3588364 missense possibly damaging 0.93
R0517:Fam208b UTSW 13 3566964 missense possibly damaging 0.94
R0586:Fam208b UTSW 13 3590321 missense probably damaging 0.99
R0600:Fam208b UTSW 13 3576054 missense probably benign
R0659:Fam208b UTSW 13 3574448 missense probably damaging 0.99
R1257:Fam208b UTSW 13 3575049 missense probably benign 0.25
R1375:Fam208b UTSW 13 3576029 missense probably benign 0.06
R1443:Fam208b UTSW 13 3575543 missense probably benign 0.00
R1497:Fam208b UTSW 13 3570409 missense probably damaging 0.96
R1544:Fam208b UTSW 13 3590413 missense possibly damaging 0.68
R1629:Fam208b UTSW 13 3574121 missense possibly damaging 0.84
R1633:Fam208b UTSW 13 3581771 missense possibly damaging 0.53
R1661:Fam208b UTSW 13 3573860 missense possibly damaging 0.63
R1673:Fam208b UTSW 13 3584498 critical splice donor site probably null
R1675:Fam208b UTSW 13 3569507 missense possibly damaging 0.65
R1781:Fam208b UTSW 13 3584759 missense possibly damaging 0.95
R1792:Fam208b UTSW 13 3590559 missense possibly damaging 0.91
R1826:Fam208b UTSW 13 3581759 missense probably damaging 0.98
R1920:Fam208b UTSW 13 3576612 missense possibly damaging 0.63
R1983:Fam208b UTSW 13 3574853 missense possibly damaging 0.92
R2016:Fam208b UTSW 13 3576770 missense probably benign 0.41
R2017:Fam208b UTSW 13 3576770 missense probably benign 0.41
R2220:Fam208b UTSW 13 3581872 missense probably benign 0.00
R2513:Fam208b UTSW 13 3582150 missense possibly damaging 0.53
R2898:Fam208b UTSW 13 3585122 missense possibly damaging 0.82
R2904:Fam208b UTSW 13 3582185 missense possibly damaging 0.53
R3149:Fam208b UTSW 13 3574359 missense probably damaging 0.98
R3623:Fam208b UTSW 13 3595556 missense probably benign
R3624:Fam208b UTSW 13 3595556 missense probably benign
R3725:Fam208b UTSW 13 3590538 missense probably benign 0.33
R3835:Fam208b UTSW 13 3575292 missense probably benign 0.01
R3890:Fam208b UTSW 13 3596785 missense probably damaging 0.96
R4023:Fam208b UTSW 13 3584554 missense probably damaging 0.99
R4024:Fam208b UTSW 13 3584554 missense probably damaging 0.99
R4025:Fam208b UTSW 13 3584554 missense probably damaging 0.99
R4050:Fam208b UTSW 13 3573507 missense probably benign 0.09
R4308:Fam208b UTSW 13 3569498 missense probably damaging 0.97
R4484:Fam208b UTSW 13 3581831 missense probably benign 0.12
R4674:Fam208b UTSW 13 3573686 missense possibly damaging 0.69
R4718:Fam208b UTSW 13 3574495 missense probably benign 0.00
R4745:Fam208b UTSW 13 3590069 missense probably benign 0.26
R4776:Fam208b UTSW 13 3570391 missense probably damaging 1.00
R4839:Fam208b UTSW 13 3584807 missense probably damaging 0.96
R4855:Fam208b UTSW 13 3566680 splice site probably null
R5049:Fam208b UTSW 13 3574000 missense probably benign 0.00
R5076:Fam208b UTSW 13 3576357 missense probably benign 0.41
R5287:Fam208b UTSW 13 3575744 missense probably benign 0.41
R5298:Fam208b UTSW 13 3595613 splice site probably null
R5379:Fam208b UTSW 13 3588496 missense probably benign 0.41
R5512:Fam208b UTSW 13 3595517 missense probably damaging 0.99
R5624:Fam208b UTSW 13 3584996 missense possibly damaging 0.66
R5750:Fam208b UTSW 13 3573642 nonsense probably null
R6114:Fam208b UTSW 13 3590081 missense probably damaging 1.00
R6118:Fam208b UTSW 13 3581891 missense possibly damaging 0.76
R6119:Fam208b UTSW 13 3581891 missense possibly damaging 0.76
R6269:Fam208b UTSW 13 3581891 missense possibly damaging 0.76
R6270:Fam208b UTSW 13 3581891 missense possibly damaging 0.76
R6271:Fam208b UTSW 13 3581891 missense possibly damaging 0.76
R6272:Fam208b UTSW 13 3581891 missense possibly damaging 0.76
R6525:Fam208b UTSW 13 3576540 nonsense probably null
R6550:Fam208b UTSW 13 3590519 missense possibly damaging 0.85
R6714:Fam208b UTSW 13 3594189 missense probably benign 0.00
R6797:Fam208b UTSW 13 3576769 missense probably benign 0.26
R6967:Fam208b UTSW 13 3574819 missense probably benign 0.22
R7016:Fam208b UTSW 13 3576857 missense possibly damaging 0.92
R7219:Fam208b UTSW 13 3590521 missense probably damaging 0.99
R7454:Fam208b UTSW 13 3585332 missense probably benign 0.21
R7570:Fam208b UTSW 13 3573621 missense probably damaging 0.99
R7571:Fam208b UTSW 13 3575292 missense probably benign 0.01
R7580:Fam208b UTSW 13 3574752 missense probably damaging 0.99
R7587:Fam208b UTSW 13 3568849 missense possibly damaging 0.83
R7657:Fam208b UTSW 13 3573777 missense probably damaging 0.98
R7810:Fam208b UTSW 13 3575714 missense possibly damaging 0.61
R7909:Fam208b UTSW 13 3573765 missense possibly damaging 0.93
R7924:Fam208b UTSW 13 3594331 missense possibly damaging 0.92
R7945:Fam208b UTSW 13 3576085 missense probably benign
R8005:Fam208b UTSW 13 3575681 missense probably benign
R8067:Fam208b UTSW 13 3569602 missense probably benign
R8112:Fam208b UTSW 13 3569516 missense probably damaging 1.00
R8162:Fam208b UTSW 13 3599691 missense probably damaging 0.96
R8170:Fam208b UTSW 13 3574881 nonsense probably null
R8240:Fam208b UTSW 13 3574388 missense probably benign
R8263:Fam208b UTSW 13 3575286 missense possibly damaging 0.70
R8263:Fam208b UTSW 13 3590016 missense probably benign 0.03
R8477:Fam208b UTSW 13 3575079 missense probably benign 0.18
R9022:Fam208b UTSW 13 3576659 missense probably benign
R9140:Fam208b UTSW 13 3588441 missense probably benign 0.04
R9167:Fam208b UTSW 13 3574724 missense probably benign
R9527:Fam208b UTSW 13 3585191 missense possibly damaging 0.61
R9535:Fam208b UTSW 13 3573559 missense possibly damaging 0.69
R9711:Fam208b UTSW 13 3599667 missense probably benign
X0024:Fam208b UTSW 13 3599837 missense probably null 0.99
X0025:Fam208b UTSW 13 3576827 missense probably benign 0.15
X0066:Fam208b UTSW 13 3588441 missense probably benign 0.04
Z1176:Fam208b UTSW 13 3576636 missense probably benign 0.01
Z1176:Fam208b UTSW 13 3588429 missense probably damaging 0.98
Z1177:Fam208b UTSW 13 3574234 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CCTCTTCCCTCTTCAGTGAGAGATCAG -3'
(R):5'- ACAAACACAAAGTTCTAGGGATGTGCC -3'

Sequencing Primer
(F):5'- GAGAGATCAGTTTGTTTGGGAAATAC -3'
(R):5'- AGATAGTAAGTGCCTTTCTGCC -3'
Posted On 2014-04-13